\
| Variant ID: vg0408410720 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8410720 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
CTACCTTGTGTTCAACCAAATTTCAAATAATCTCATTTCTCAAAACATATTCTTGGAAAAGAACACATGTGGGTAATCATCGTGAGATGTAGACCTCTGT[G/A]
AGATGGGCGAGGTGCTCGCTGCCTATGTTATGACCAGTGCGGCCAATTTCTAGGGCTCTATCGGGTAATCATCTCAAAATGTAGACCACTTTATGATGGG
CCCATCATAAAGTGGTCTACATTTTGAGATGATTACCCGATAGAGCCCTAGAAATTGGCCGCACTGGTCATAACATAGGCAGCGAGCACCTCGCCCATCT[C/T]
ACAGAGGTCTACATCTCACGATGATTACCCACATGTGTTCTTTTCCAAGAATATGTTTTGAGAAATGAGATTATTTGAAATTTGGTTGAACACAAGGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 5.10% | 16.74% | 40.25% | NA |
| All Indica | 2759 | 25.40% | 0.30% | 23.38% | 51.00% | NA |
| All Japonica | 1512 | 63.00% | 14.50% | 4.03% | 18.45% | NA |
| Aus | 269 | 13.40% | 0.00% | 18.22% | 68.40% | NA |
| Indica I | 595 | 8.20% | 0.00% | 8.91% | 82.86% | NA |
| Indica II | 465 | 19.40% | 1.10% | 23.66% | 55.91% | NA |
| Indica III | 913 | 38.00% | 0.00% | 39.21% | 22.78% | NA |
| Indica Intermediate | 786 | 27.20% | 0.30% | 15.78% | 56.74% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 0.52% | 3.13% | NA |
| Tropical Japonica | 504 | 8.50% | 40.90% | 10.52% | 40.08% | NA |
| Japonica Intermediate | 241 | 71.00% | 5.40% | 1.66% | 21.99% | NA |
| VI/Aromatic | 96 | 69.80% | 8.30% | 16.67% | 5.21% | NA |
| Intermediate | 90 | 37.80% | 10.00% | 22.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408410720 | G -> DEL | N | N | silent_mutation | Average:12.509; most accessible tissue: Callus, score: 34.144 | N | N | N | N |
| vg0408410720 | G -> A | LOC_Os04g14960.1 | upstream_gene_variant ; 1758.0bp to feature; MODIFIER | silent_mutation | Average:12.509; most accessible tissue: Callus, score: 34.144 | N | N | N | N |
| vg0408410720 | G -> A | LOC_Os04g14970.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.509; most accessible tissue: Callus, score: 34.144 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408410720 | NA | 3.03E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 7.07E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 7.35E-06 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 2.85E-13 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 2.03E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 1.08E-09 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 5.90E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 3.48E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 3.22E-07 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 3.14E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 3.18E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 6.31E-08 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 9.45E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 3.31E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 1.89E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 4.13E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 2.35E-07 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 1.81E-13 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 8.93E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 8.96E-09 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 6.62E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 5.02E-07 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | NA | 4.37E-13 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408410720 | 4.77E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |