\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408380913:

Variant ID: vg0408380913 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8380913
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGAACCTTCCTCAACGAAAGCGCTCTCCTCCGGAACGTCGGAAACTAAAGCAAAAGAACAAAATCAACAAAACAGTACAAAAACAAGCATAAACAGTA[C/T]
ATGTGGATATTTTTAGTATGTAGATCTTGATTTTAGAAAAATTTAGCAACTTGAACCACTCGAATCGGAGTTACGATGATTTAGTTACGAATTTCCAAAG

Reverse complement sequence

CTTTGGAAATTCGTAACTAAATCATCGTAACTCCGATTCGAGTGGTTCAAGTTGCTAAATTTTTCTAAAATCAAGATCTACATACTAAAAATATCCACAT[G/A]
TACTGTTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTGTTCTTTTGCTTTAGTTTCCGACGTTCCGGAGGAGAGCGCTTTCGTTGAGGAAGGTTCGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 3.80% 35.93% 26.75% NA
All Indica  2759 18.60% 4.50% 43.57% 33.38% NA
All Japonica  1512 66.20% 2.00% 16.34% 15.48% NA
Aus  269 14.90% 5.20% 53.90% 26.02% NA
Indica I  595 28.90% 0.70% 36.47% 33.95% NA
Indica II  465 18.70% 2.40% 43.01% 35.91% NA
Indica III  913 11.30% 9.00% 48.30% 31.43% NA
Indica Intermediate  786 19.10% 3.40% 43.77% 33.72% NA
Temperate Japonica  767 96.20% 0.00% 0.52% 3.26% NA
Tropical Japonica  504 17.70% 5.80% 41.47% 35.12% NA
Japonica Intermediate  241 72.20% 0.40% 14.11% 13.28% NA
VI/Aromatic  96 3.10% 7.30% 71.88% 17.71% NA
Intermediate  90 33.30% 3.30% 38.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408380913 C -> DEL N N silent_mutation Average:8.47; most accessible tissue: Callus, score: 16.142 N N N N
vg0408380913 C -> T LOC_Os04g14890.1 upstream_gene_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:8.47; most accessible tissue: Callus, score: 16.142 N N N N
vg0408380913 C -> T LOC_Os04g14900.1 downstream_gene_variant ; 2218.0bp to feature; MODIFIER silent_mutation Average:8.47; most accessible tissue: Callus, score: 16.142 N N N N
vg0408380913 C -> T LOC_Os04g14890-LOC_Os04g14900 intergenic_region ; MODIFIER silent_mutation Average:8.47; most accessible tissue: Callus, score: 16.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408380913 1.90E-07 NA mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913 6.55E-06 NA mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913 7.53E-07 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913 2.58E-06 NA mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913 8.85E-06 1.32E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251