RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0408380913:

Variant ID: vg0408380913 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8380913
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGAACCTTCCTCAACGAAAGCGCTCTCCTCCGGAACGTCGGAAACTAAAGCAAAAGAACAAAATCAACAAAACAGTACAAAAACAAGCATAAACAGTA[C/T]
ATGTGGATATTTTTAGTATGTAGATCTTGATTTTAGAAAAATTTAGCAACTTGAACCACTCGAATCGGAGTTACGATGATTTAGTTACGAATTTCCAAAG

Reverse complement sequence

CTTTGGAAATTCGTAACTAAATCATCGTAACTCCGATTCGAGTGGTTCAAGTTGCTAAATTTTTCTAAAATCAAGATCTACATACTAAAAATATCCACAT[G/A]
TACTGTTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTGTTCTTTTGCTTTAGTTTCCGACGTTCCGGAGGAGAGCGCTTTCGTTGAGGAAGGTTCGGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	3.80%	35.93%	26.75%	NA
All Indica	2759	18.60%	4.50%	43.57%	33.38%	NA
All Japonica	1512	66.20%	2.00%	16.34%	15.48%	NA
Aus	269	14.90%	5.20%	53.90%	26.02%	NA
Indica I	595	28.90%	0.70%	36.47%	33.95%	NA
Indica II	465	18.70%	2.40%	43.01%	35.91%	NA
Indica III	913	11.30%	9.00%	48.30%	31.43%	NA
Indica Intermediate	786	19.10%	3.40%	43.77%	33.72%	NA
Temperate Japonica	767	96.20%	0.00%	0.52%	3.26%	NA
Tropical Japonica	504	17.70%	5.80%	41.47%	35.12%	NA
Japonica Intermediate	241	72.20%	0.40%	14.11%	13.28%	NA
VI/Aromatic	96	3.10%	7.30%	71.88%	17.71%	NA
Intermediate	90	33.30%	3.30%	38.89%	24.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408380913	C -> DEL	N	N	silent_mutation	Average:8.47; most accessible tissue: Callus, score: 16.142	N	N	N	N
vg0408380913	C -> T	LOC_Os04g14890.1	upstream_gene_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:8.47; most accessible tissue: Callus, score: 16.142	N	N	N	N
vg0408380913	C -> T	LOC_Os04g14900.1	downstream_gene_variant ; 2218.0bp to feature; MODIFIER	silent_mutation	Average:8.47; most accessible tissue: Callus, score: 16.142	N	N	N	N
vg0408380913	C -> T	LOC_Os04g14890-LOC_Os04g14900	intergenic_region ; MODIFIER	silent_mutation	Average:8.47; most accessible tissue: Callus, score: 16.142	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408380913	1.90E-07	NA	mr1016	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913	6.55E-06	NA	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913	7.53E-07	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913	2.58E-06	NA	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408380913	8.85E-06	1.32E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0408380913:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact