\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408360478:

Variant ID: vg0408360478 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8360478
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CGACGACGCTAGGTAAGATTGAACGGAATAGATTACATAGATGAATTGATGATTGCAGAAGCAAACCCATCAACAGAGAGTGAGAACGGAGTACCAGCGG[C/T]
GCAACGGCGACGACGGCGATGGCGGGAGGCGGCGGCACTTGCCGGCGGCTGTGGGACAGCAAGCGGCGGCGGCGGCGGCTGCGGCTAGAGCTAGAGCAAA

Reverse complement sequence

TTTGCTCTAGCTCTAGCCGCAGCCGCCGCCGCCGCCGCTTGCTGTCCCACAGCCGCCGGCAAGTGCCGCCGCCTCCCGCCATCGCCGTCGTCGCCGTTGC[G/A]
CCGCTGGTACTCCGTTCTCACTCTCTGTTGATGGGTTTGCTTCTGCAATCATCAATTCATCTATGTAATCTATTCCGTTCAATCTTACCTAGCGTCGTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 26.50% 7.77% 4.34% NA
All Indica  2759 42.00% 44.70% 8.88% 4.42% NA
All Japonica  1512 88.80% 0.40% 6.55% 4.30% NA
Aus  269 88.50% 0.00% 6.32% 5.20% NA
Indica I  595 18.80% 65.90% 11.93% 3.36% NA
Indica II  465 36.80% 40.40% 12.90% 9.89% NA
Indica III  913 58.40% 35.90% 2.63% 3.07% NA
Indica Intermediate  786 43.50% 41.50% 11.45% 3.56% NA
Temperate Japonica  767 81.40% 0.30% 10.56% 7.82% NA
Tropical Japonica  504 98.40% 0.40% 0.60% 0.60% NA
Japonica Intermediate  241 92.10% 0.80% 6.22% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 74.40% 15.60% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408360478 C -> DEL N N silent_mutation Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0408360478 C -> T LOC_Os04g14860.1 upstream_gene_variant ; 1958.0bp to feature; MODIFIER silent_mutation Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0408360478 C -> T LOC_Os04g14870.1 upstream_gene_variant ; 3349.0bp to feature; MODIFIER silent_mutation Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0408360478 C -> T LOC_Os04g14860-LOC_Os04g14870 intergenic_region ; MODIFIER silent_mutation Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408360478 NA 5.11E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 4.11E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 4.81E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 2.32E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 3.68E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 6.51E-06 NA mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 4.47E-06 8.77E-11 mr1830 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 1.29E-08 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 1.20E-08 2.76E-16 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 7.00E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 NA 7.09E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 2.94E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 8.61E-06 1.11E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 6.51E-10 9.25E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360478 4.40E-09 5.10E-29 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251