\
| Variant ID: vg0408360478 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8360478 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )
CGACGACGCTAGGTAAGATTGAACGGAATAGATTACATAGATGAATTGATGATTGCAGAAGCAAACCCATCAACAGAGAGTGAGAACGGAGTACCAGCGG[C/T]
GCAACGGCGACGACGGCGATGGCGGGAGGCGGCGGCACTTGCCGGCGGCTGTGGGACAGCAAGCGGCGGCGGCGGCGGCTGCGGCTAGAGCTAGAGCAAA
TTTGCTCTAGCTCTAGCCGCAGCCGCCGCCGCCGCCGCTTGCTGTCCCACAGCCGCCGGCAAGTGCCGCCGCCTCCCGCCATCGCCGTCGTCGCCGTTGC[G/A]
CCGCTGGTACTCCGTTCTCACTCTCTGTTGATGGGTTTGCTTCTGCAATCATCAATTCATCTATGTAATCTATTCCGTTCAATCTTACCTAGCGTCGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 26.50% | 7.77% | 4.34% | NA |
| All Indica | 2759 | 42.00% | 44.70% | 8.88% | 4.42% | NA |
| All Japonica | 1512 | 88.80% | 0.40% | 6.55% | 4.30% | NA |
| Aus | 269 | 88.50% | 0.00% | 6.32% | 5.20% | NA |
| Indica I | 595 | 18.80% | 65.90% | 11.93% | 3.36% | NA |
| Indica II | 465 | 36.80% | 40.40% | 12.90% | 9.89% | NA |
| Indica III | 913 | 58.40% | 35.90% | 2.63% | 3.07% | NA |
| Indica Intermediate | 786 | 43.50% | 41.50% | 11.45% | 3.56% | NA |
| Temperate Japonica | 767 | 81.40% | 0.30% | 10.56% | 7.82% | NA |
| Tropical Japonica | 504 | 98.40% | 0.40% | 0.60% | 0.60% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.80% | 6.22% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 15.60% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408360478 | C -> DEL | N | N | silent_mutation | Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0408360478 | C -> T | LOC_Os04g14860.1 | upstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0408360478 | C -> T | LOC_Os04g14870.1 | upstream_gene_variant ; 3349.0bp to feature; MODIFIER | silent_mutation | Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0408360478 | C -> T | LOC_Os04g14860-LOC_Os04g14870 | intergenic_region ; MODIFIER | silent_mutation | Average:56.394; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408360478 | NA | 5.11E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 4.11E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 4.81E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 2.32E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 3.68E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 6.51E-06 | NA | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 4.47E-06 | 8.77E-11 | mr1830 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 1.29E-08 | NA | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 1.20E-08 | 2.76E-16 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 7.00E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | NA | 7.09E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 2.94E-06 | NA | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 8.61E-06 | 1.11E-14 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 6.51E-10 | 9.25E-14 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408360478 | 4.40E-09 | 5.10E-29 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |