Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408360452:

Variant ID: vg0408360452 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8360452
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGCCGGTGAGCTCGGGATCGACGACGACGACGCTAGGTAAGATTGAACGGAATAGATTACATAGATGAATTGATGATTGCAGAAGCAAACCCATCAAC[A/C]
GAGAGTGAGAACGGAGTACCAGCGGCGCAACGGCGACGACGGCGATGGCGGGAGGCGGCGGCACTTGCCGGCGGCTGTGGGACAGCAAGCGGCGGCGGCG

Reverse complement sequence

CGCCGCCGCCGCTTGCTGTCCCACAGCCGCCGGCAAGTGCCGCCGCCTCCCGCCATCGCCGTCGTCGCCGTTGCGCCGCTGGTACTCCGTTCTCACTCTC[T/G]
GTTGATGGGTTTGCTTCTGCAATCATCAATTCATCTATGTAATCTATTCCGTTCAATCTTACCTAGCGTCGTCGTCGTCGATCCCGAGCTCACCGGCGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	13.60%	4.32%	2.79%	NA
All Indica	2759	93.20%	0.40%	4.31%	2.07%	NA
All Japonica	1512	56.00%	35.20%	4.30%	4.50%	NA
Aus	269	92.20%	0.00%	6.32%	1.49%	NA
Indica I	595	93.40%	0.00%	4.71%	1.85%	NA
Indica II	465	86.90%	0.90%	9.25%	3.01%	NA
Indica III	913	96.10%	0.20%	1.75%	1.97%	NA
Indica Intermediate	786	93.50%	0.60%	4.07%	1.78%	NA
Temperate Japonica	767	81.70%	3.70%	6.39%	8.21%	NA
Tropical Japonica	504	11.50%	87.10%	0.79%	0.60%	NA
Japonica Intermediate	241	67.20%	27.00%	4.98%	0.83%	NA
VI/Aromatic	96	18.80%	80.20%	1.04%	0.00%	NA
Intermediate	90	70.00%	24.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408360452	A -> C	LOC_Os04g14860.1	upstream_gene_variant ; 1932.0bp to feature; MODIFIER	silent_mutation	Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412	N	N	N	N
vg0408360452	A -> C	LOC_Os04g14870.1	upstream_gene_variant ; 3375.0bp to feature; MODIFIER	silent_mutation	Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412	N	N	N	N
vg0408360452	A -> C	LOC_Os04g14860-LOC_Os04g14870	intergenic_region ; MODIFIER	silent_mutation	Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412	N	N	N	N
vg0408360452	A -> DEL	N	N	silent_mutation	Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408360452	NA	1.52E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	1.62E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	4.21E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	1.01E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.48E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.80E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	3.81E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	7.02E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	1.02E-06	NA	mr1403	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	8.38E-06	7.17E-09	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.03E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	9.96E-13	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	8.49E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	3.27E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.98E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.63E-08	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	3.30E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	5.60E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	5.88E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	1.19E-07	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	9.76E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452	NA	2.06E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251