\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408360452:

Variant ID: vg0408360452 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8360452
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGCCGGTGAGCTCGGGATCGACGACGACGACGCTAGGTAAGATTGAACGGAATAGATTACATAGATGAATTGATGATTGCAGAAGCAAACCCATCAAC[A/C]
GAGAGTGAGAACGGAGTACCAGCGGCGCAACGGCGACGACGGCGATGGCGGGAGGCGGCGGCACTTGCCGGCGGCTGTGGGACAGCAAGCGGCGGCGGCG

Reverse complement sequence

CGCCGCCGCCGCTTGCTGTCCCACAGCCGCCGGCAAGTGCCGCCGCCTCCCGCCATCGCCGTCGTCGCCGTTGCGCCGCTGGTACTCCGTTCTCACTCTC[T/G]
GTTGATGGGTTTGCTTCTGCAATCATCAATTCATCTATGTAATCTATTCCGTTCAATCTTACCTAGCGTCGTCGTCGTCGATCCCGAGCTCACCGGCGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 13.60% 4.32% 2.79% NA
All Indica  2759 93.20% 0.40% 4.31% 2.07% NA
All Japonica  1512 56.00% 35.20% 4.30% 4.50% NA
Aus  269 92.20% 0.00% 6.32% 1.49% NA
Indica I  595 93.40% 0.00% 4.71% 1.85% NA
Indica II  465 86.90% 0.90% 9.25% 3.01% NA
Indica III  913 96.10% 0.20% 1.75% 1.97% NA
Indica Intermediate  786 93.50% 0.60% 4.07% 1.78% NA
Temperate Japonica  767 81.70% 3.70% 6.39% 8.21% NA
Tropical Japonica  504 11.50% 87.10% 0.79% 0.60% NA
Japonica Intermediate  241 67.20% 27.00% 4.98% 0.83% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 70.00% 24.40% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408360452 A -> C LOC_Os04g14860.1 upstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0408360452 A -> C LOC_Os04g14870.1 upstream_gene_variant ; 3375.0bp to feature; MODIFIER silent_mutation Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0408360452 A -> C LOC_Os04g14860-LOC_Os04g14870 intergenic_region ; MODIFIER silent_mutation Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0408360452 A -> DEL N N silent_mutation Average:56.176; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408360452 NA 1.52E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 1.62E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 4.21E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 1.01E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.48E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.80E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 3.81E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 7.02E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 1.02E-06 NA mr1403 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 8.38E-06 7.17E-09 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.03E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 9.96E-13 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 8.49E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 3.27E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.98E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.63E-08 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 3.30E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 5.60E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 5.88E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 1.19E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 9.76E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408360452 NA 2.06E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251