\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408349202:

Variant ID: vg0408349202 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8349202
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATTATAGATTTTGCCTGTAAACTGCAAGACGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATTTTTACTGTAGCATCACATTGTCAAACCAT[A/G]
GCGTAATTAGGCTCAAAAGAATCGTCTCGCAATTTACATGCAAACTGTGCAATTGGTTTTTTCATCCACATTTAATGCCCTATGCATGCGTCCAAACATT

Reverse complement sequence

AATGTTTGGACGCATGCATAGGGCATTAAATGTGGATGAAAAAACCAATTGCACAGTTTGCATGTAAATTGCGAGACGATTCTTTTGAGCCTAATTACGC[T/C]
ATGGTTTGACAATGTGATGCTACAGTAAAAATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCGTCTTGCAGTTTACAGGCAAAATCTATAATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 22.80% 1.06% 13.10% NA
All Indica  2759 93.90% 4.20% 1.63% 0.22% NA
All Japonica  1512 2.70% 62.30% 0.26% 34.72% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 89.40% 7.10% 3.53% 0.00% NA
Indica II  465 94.60% 3.20% 1.51% 0.65% NA
Indica III  913 96.80% 2.80% 0.11% 0.22% NA
Indica Intermediate  786 93.60% 4.20% 2.04% 0.13% NA
Temperate Japonica  767 0.50% 95.80% 0.00% 3.65% NA
Tropical Japonica  504 5.40% 8.10% 0.60% 85.91% NA
Japonica Intermediate  241 4.10% 68.90% 0.41% 26.56% NA
VI/Aromatic  96 26.00% 1.00% 0.00% 72.92% NA
Intermediate  90 58.90% 20.00% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408349202 A -> DEL N N silent_mutation Average:45.918; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0408349202 A -> G LOC_Os04g14840.1 upstream_gene_variant ; 669.0bp to feature; MODIFIER silent_mutation Average:45.918; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0408349202 A -> G LOC_Os04g14850.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:45.918; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0408349202 A -> G LOC_Os04g14840-LOC_Os04g14850 intergenic_region ; MODIFIER silent_mutation Average:45.918; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408349202 NA 9.69E-77 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 1.32E-63 mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.81E-70 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.91E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 1.44E-52 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.60E-68 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.72E-52 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.93E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.67E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.12E-79 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 1.39E-75 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 1.03E-80 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 4.18E-72 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.86E-52 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 5.72E-07 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.91E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.43E-75 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 3.45E-75 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349202 NA 2.09E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251