\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408349183:

Variant ID: vg0408349183 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8349183
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAGACTAATAACAAAACAAATTATAGATTTTGCCTGTAAACTGCAAGACGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATTTTTACTGTAG[C/T]
ATCACATTGTCAAACCATAGCGTAATTAGGCTCAAAAGAATCGTCTCGCAATTTACATGCAAACTGTGCAATTGGTTTTTTCATCCACATTTAATGCCCT

Reverse complement sequence

AGGGCATTAAATGTGGATGAAAAAACCAATTGCACAGTTTGCATGTAAATTGCGAGACGATTCTTTTGAGCCTAATTACGCTATGGTTTGACAATGTGAT[G/A]
CTACAGTAAAAATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCGTCTTGCAGTTTACAGGCAAAATCTATAATTTGTTTTGTTATTAGTCTATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 25.90% 0.70% 13.06% NA
All Indica  2759 55.40% 43.60% 0.72% 0.25% NA
All Japonica  1512 64.60% 0.40% 0.53% 34.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 31.80% 67.10% 1.18% 0.00% NA
Indica II  465 74.40% 24.70% 0.22% 0.65% NA
Indica III  913 59.50% 40.20% 0.11% 0.22% NA
Indica Intermediate  786 57.40% 41.00% 1.40% 0.25% NA
Temperate Japonica  767 96.30% 0.00% 0.00% 3.65% NA
Tropical Japonica  504 12.70% 0.80% 1.39% 85.12% NA
Japonica Intermediate  241 72.20% 0.80% 0.41% 26.56% NA
VI/Aromatic  96 20.80% 1.00% 4.17% 73.96% NA
Intermediate  90 65.60% 13.30% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408349183 C -> DEL N N silent_mutation Average:53.129; most accessible tissue: Zhenshan97 flower, score: 91.322 N N N N
vg0408349183 C -> T LOC_Os04g14840.1 upstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:53.129; most accessible tissue: Zhenshan97 flower, score: 91.322 N N N N
vg0408349183 C -> T LOC_Os04g14850.1 downstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:53.129; most accessible tissue: Zhenshan97 flower, score: 91.322 N N N N
vg0408349183 C -> T LOC_Os04g14840-LOC_Os04g14850 intergenic_region ; MODIFIER silent_mutation Average:53.129; most accessible tissue: Zhenshan97 flower, score: 91.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408349183 NA 3.21E-08 mr1386 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 4.37E-11 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 1.66E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 7.65E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 4.90E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 3.76E-07 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 8.11E-07 5.75E-12 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 5.79E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 5.56E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 1.30E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 6.04E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 NA 5.86E-12 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 4.82E-12 2.79E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408349183 3.35E-10 5.48E-27 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251