Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0408307133:

Variant ID: vg0408307133 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8307133
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAAACATTTGCTAATGACATATTAATTAGACTTAATAAATTCGCCTCGCAGTTTACAGGCGAAATCTATAATTTATTTTATTATTAGACTACGTTTAAT[A/T]
CTTCAAATGTGTATCCGTATATTCGATGTGACATGTCAAAACTTTTTACCCCTAAAACTAAACAGGGCCTTGATCAAAATGAAAATTCCCGGATACGGAA

Reverse complement sequence

TTCCGTATCCGGGAATTTTCATTTTGATCAAGGCCCTGTTTAGTTTTAGGGGTAAAAAGTTTTGACATGTCACATCGAATATACGGATACACATTTGAAG[T/A]
ATTAAACGTAGTCTAATAATAAAATAAATTATAGATTTCGCCTGTAAACTGCGAGGCGAATTTATTAAGTCTAATTAATATGTCATTAGCAAATGTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	2.60%	19.04%	4.82%	NA
All Indica	2759	62.30%	0.00%	29.47%	8.23%	NA
All Japonica	1512	87.00%	7.80%	5.16%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	31.60%	0.00%	54.96%	13.45%	NA
Indica II	465	77.40%	0.00%	16.34%	6.24%	NA
Indica III	913	70.40%	0.00%	23.33%	6.24%	NA
Indica Intermediate	786	67.20%	0.00%	25.06%	7.76%	NA
Temperate Japonica	767	76.90%	14.00%	9.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	1.20%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	3.30%	10.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408307133	A -> DEL	N	N	silent_mutation	Average:65.044; most accessible tissue: Minghui63 young leaf, score: 83.166	N	N	N	N
vg0408307133	A -> T	LOC_Os04g14790.1	downstream_gene_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:65.044; most accessible tissue: Minghui63 young leaf, score: 83.166	N	N	N	N
vg0408307133	A -> T	LOC_Os04g14780-LOC_Os04g14790	intergenic_region ; MODIFIER	silent_mutation	Average:65.044; most accessible tissue: Minghui63 young leaf, score: 83.166	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0408307133	A	T	-0.01	-0.02	-0.01	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408307133	1.69E-07	NA	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	NA	3.60E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	2.02E-09	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	3.39E-06	3.41E-11	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	4.98E-08	1.47E-09	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	1.32E-07	1.32E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	1.65E-06	NA	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	NA	5.66E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	2.37E-07	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	NA	1.47E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	1.87E-08	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	7.38E-06	2.42E-09	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	8.17E-08	8.16E-08	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	1.90E-08	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408307133	NA	4.18E-09	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251