\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408294706:

Variant ID: vg0408294706 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8294706
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GGACGGACTCCCCCAGGTCGCCGACCTCCTCCATCACATCCTTGCTCGCATCGCTAGCCGCCCCCTGATCCAAGATCTTCCGCAGATCGAGTTCAGGATG[T/C]
GCCAGCCTCACACACGCAAGGACATGGCACACCCCGGTATAGATCCCGTTGAACGTCTCCTCTCCGACCCTGGCCGCGTGCTTGGAGGGGATCGCCTCCA

Reverse complement sequence

TGGAGGCGATCCCCTCCAAGCACGCGGCCAGGGTCGGAGAGGAGACGTTCAACGGGATCTATACCGGGGTGTGCCATGTCCTTGCGTGTGTGAGGCTGGC[A/G]
CATCCTGAACTCGATCTGCGGAAGATCTTGGATCAGGGGGCGGCTAGCGATGCGAGCAAGGATGTGATGGAGGAGGTCGGCGACCTGGGGGAGTCCGTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.50% 16.20% 1.69% 61.57% NA
All Indica  2759 1.10% 7.90% 1.92% 89.13% NA
All Japonica  1512 60.90% 24.90% 1.19% 13.03% NA
Aus  269 0.00% 32.70% 0.00% 67.29% NA
Indica I  595 1.00% 0.70% 2.52% 95.80% NA
Indica II  465 2.20% 26.70% 2.37% 68.82% NA
Indica III  913 0.40% 4.40% 1.10% 94.09% NA
Indica Intermediate  786 1.30% 6.20% 2.16% 90.33% NA
Temperate Japonica  767 95.80% 1.20% 0.26% 2.74% NA
Tropical Japonica  504 6.50% 65.10% 2.18% 26.19% NA
Japonica Intermediate  241 63.50% 16.20% 2.07% 18.26% NA
VI/Aromatic  96 0.00% 58.30% 3.12% 38.54% NA
Intermediate  90 21.10% 32.20% 6.67% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408294706 T -> C LOC_Os04g14780.1 synonymous_variant ; p.Ala311Ala; LOW synonymous_codon Average:19.383; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0408294706 T -> DEL LOC_Os04g14780.1 N frameshift_variant Average:19.383; most accessible tissue: Minghui63 root, score: 45.031 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408294706 NA 1.98E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 8.63E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 1.29E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 7.47E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 5.92E-06 5.92E-06 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 9.57E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 5.68E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 2.03E-06 NA mr1070_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 3.90E-10 3.90E-10 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 5.79E-06 1.35E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 5.41E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 2.98E-07 1.16E-11 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 7.93E-07 1.51E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 6.07E-07 3.78E-08 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 1.38E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 4.81E-08 6.01E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 2.06E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 1.71E-07 5.17E-09 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 1.23E-07 1.23E-07 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 1.68E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 3.34E-08 2.58E-12 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 2.90E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 3.85E-08 1.05E-11 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 NA 7.41E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294706 7.03E-06 NA mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251