RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0408294186:

Variant ID: vg0408294186 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8294186
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.48, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCACGACCCCGGAGTGTCTCTACGGCCTGATCCTTCTTCACTTCCAGCATAGTCCTCTCGAGTTCCGCGACCTCAAACTTCATCCTCCAATACTGGATGC[A/G]
ACGATCCTGGTCTGCGCAGCATGGAAACGATTAAGTCAAGCTGCTCTTCTCTCCCGAGAATACAACAAATCAAGTCGACCCAGATGGAAGCGTAAAGGAA

Reverse complement sequence

TTCCTTTACGCTTCCATCTGGGTCGACTTGATTTGTTGTATTCTCGGGAGAGAAGAGCAGCTTGACTTAATCGTTTCCATGCTGCGCAGACCAGGATCGT[T/C]
GCATCCAGTATTGGAGGATGAAGTTTGAGGTCGCGGAACTCGAGAGGACTATGCTGGAAGTGAAGAAGGATCAGGCCGTAGAGACACTCCGGGGTCGTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.10%	10.70%	4.02%	64.18%	NA
All Indica	2759	2.00%	17.20%	1.70%	79.09%	NA
All Japonica	1512	61.00%	0.90%	4.43%	33.66%	NA
Aus	269	0.00%	3.30%	24.16%	72.49%	NA
Indica I	595	1.70%	0.50%	1.01%	96.81%	NA
Indica II	465	2.20%	8.00%	1.08%	88.82%	NA
Indica III	913	2.20%	36.00%	1.53%	60.24%	NA
Indica Intermediate	786	1.90%	13.50%	2.80%	81.81%	NA
Temperate Japonica	767	95.80%	0.00%	0.00%	4.17%	NA
Tropical Japonica	504	6.70%	0.40%	12.70%	80.16%	NA
Japonica Intermediate	241	63.50%	5.00%	1.24%	30.29%	NA
VI/Aromatic	96	0.00%	3.10%	7.29%	89.58%	NA
Intermediate	90	24.40%	3.30%	4.44%	67.78%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408294186	A -> DEL	LOC_Os04g14780.1	N	frameshift_variant	Average:23.209; most accessible tissue: Callus, score: 39.676	N	N	N	N
vg0408294186	A -> G	LOC_Os04g14780.1	missense_variant ; p.Cys403Arg; MODERATE	nonsynonymous_codon ; C403H	Average:23.209; most accessible tissue: Callus, score: 39.676	probably damaging	-2.626	TOLERATED	0.06
vg0408294186	A -> G	LOC_Os04g14780.1	missense_variant ; p.Cys403Arg; MODERATE	nonsynonymous_codon ; C403R	Average:23.209; most accessible tissue: Callus, score: 39.676	probably damaging	-3.062	TOLERATED	1.00

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408294186	7.75E-07	2.95E-08	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	3.93E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	3.88E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	1.92E-06	NA	mr1104	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	6.92E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	2.55E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	5.80E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	9.83E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	2.72E-06	2.72E-06	mr1436	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186	NA	1.90E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 37 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0408294186:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact