\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408294186:

Variant ID: vg0408294186 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8294186
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.48, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCACGACCCCGGAGTGTCTCTACGGCCTGATCCTTCTTCACTTCCAGCATAGTCCTCTCGAGTTCCGCGACCTCAAACTTCATCCTCCAATACTGGATGC[A/G]
ACGATCCTGGTCTGCGCAGCATGGAAACGATTAAGTCAAGCTGCTCTTCTCTCCCGAGAATACAACAAATCAAGTCGACCCAGATGGAAGCGTAAAGGAA

Reverse complement sequence

TTCCTTTACGCTTCCATCTGGGTCGACTTGATTTGTTGTATTCTCGGGAGAGAAGAGCAGCTTGACTTAATCGTTTCCATGCTGCGCAGACCAGGATCGT[T/C]
GCATCCAGTATTGGAGGATGAAGTTTGAGGTCGCGGAACTCGAGAGGACTATGCTGGAAGTGAAGAAGGATCAGGCCGTAGAGACACTCCGGGGTCGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.10% 10.70% 4.02% 64.18% NA
All Indica  2759 2.00% 17.20% 1.70% 79.09% NA
All Japonica  1512 61.00% 0.90% 4.43% 33.66% NA
Aus  269 0.00% 3.30% 24.16% 72.49% NA
Indica I  595 1.70% 0.50% 1.01% 96.81% NA
Indica II  465 2.20% 8.00% 1.08% 88.82% NA
Indica III  913 2.20% 36.00% 1.53% 60.24% NA
Indica Intermediate  786 1.90% 13.50% 2.80% 81.81% NA
Temperate Japonica  767 95.80% 0.00% 0.00% 4.17% NA
Tropical Japonica  504 6.70% 0.40% 12.70% 80.16% NA
Japonica Intermediate  241 63.50% 5.00% 1.24% 30.29% NA
VI/Aromatic  96 0.00% 3.10% 7.29% 89.58% NA
Intermediate  90 24.40% 3.30% 4.44% 67.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408294186 A -> DEL LOC_Os04g14780.1 N frameshift_variant Average:23.209; most accessible tissue: Callus, score: 39.676 N N N N
vg0408294186 A -> G LOC_Os04g14780.1 missense_variant ; p.Cys403Arg; MODERATE nonsynonymous_codon ; C403H Average:23.209; most accessible tissue: Callus, score: 39.676 probably damaging -2.626 TOLERATED 0.06
vg0408294186 A -> G LOC_Os04g14780.1 missense_variant ; p.Cys403Arg; MODERATE nonsynonymous_codon ; C403R Average:23.209; most accessible tissue: Callus, score: 39.676 probably damaging -3.062 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408294186 7.75E-07 2.95E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 3.93E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 3.88E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.92E-06 NA mr1104 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 6.92E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 2.55E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 5.80E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 9.83E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 2.72E-06 2.72E-06 mr1436 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 1.90E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 8.33E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 5.53E-06 8.63E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.65E-06 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 2.09E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 2.01E-10 2.01E-10 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.18E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 2.13E-06 4.58E-11 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 9.81E-10 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.02E-07 6.08E-12 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 7.07E-07 1.06E-06 mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.41E-09 NA mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.00E-07 5.45E-09 mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 3.29E-11 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.41E-08 2.64E-08 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 6.96E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 5.49E-08 2.22E-09 mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 3.79E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.54E-07 1.54E-07 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 9.67E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 1.32E-12 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 4.97E-09 5.11E-13 mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 1.58E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 1.84E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 6.97E-07 NA mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 4.19E-08 1.56E-11 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 NA 5.00E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408294186 8.47E-06 NA mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251