\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408293770:

Variant ID: vg0408293770 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8293770
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCCTAAGACATTTGTCACAGGACACGGAGACTACCAGGAAGGCCAACGCCAGTGATTGACTGGAAGACCTTCTCCGCCAGCAGCGCCATCGACTTCGC[T/C]
AGACCATCTATCTCCGTAGGAGTTCTCCGAGAACGAGAAAACCCTTCGCGGAGGAACTCGAGGTGCAGCTGCGGACGATGATCTCGTATGCAAGCCAACA

Reverse complement sequence

TGTTGGCTTGCATACGAGATCATCGTCCGCAGCTGCACCTCGAGTTCCTCCGCGAAGGGTTTTCTCGTTCTCGGAGAACTCCTACGGAGATAGATGGTCT[A/G]
GCGAAGTCGATGGCGCTGCTGGCGGAGAAGGTCTTCCAGTCAATCACTGGCGTTGGCCTTCCTGGTAGTCTCCGTGTCCTGTGACAAATGTCTTAGGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.80% 0.40% 8.89% 68.92% NA
All Indica  2759 2.60% 0.60% 2.50% 94.24% NA
All Japonica  1512 61.80% 0.00% 16.40% 21.83% NA
Aus  269 0.70% 0.00% 21.19% 78.07% NA
Indica I  595 2.00% 0.30% 0.34% 97.31% NA
Indica II  465 3.00% 0.40% 6.24% 90.32% NA
Indica III  913 3.40% 1.30% 1.97% 93.32% NA
Indica Intermediate  786 2.00% 0.10% 2.54% 95.29% NA
Temperate Japonica  767 95.80% 0.00% 0.26% 3.91% NA
Tropical Japonica  504 6.50% 0.00% 45.24% 48.21% NA
Japonica Intermediate  241 68.90% 0.00% 7.47% 23.65% NA
VI/Aromatic  96 0.00% 0.00% 42.71% 57.29% NA
Intermediate  90 25.60% 0.00% 5.56% 68.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408293770 T -> C LOC_Os04g14780.1 synonymous_variant ; p.Leu541Leu; LOW synonymous_codon Average:20.375; most accessible tissue: Callus, score: 41.078 N N N N
vg0408293770 T -> DEL LOC_Os04g14780.1 N frameshift_variant Average:20.375; most accessible tissue: Callus, score: 41.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408293770 6.07E-07 3.68E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 5.34E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 2.63E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 9.25E-06 NA mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 8.52E-06 8.52E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 2.78E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 2.91E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 3.63E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.78E-06 3.79E-06 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 2.71E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 5.08E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.44E-10 3.44E-10 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 6.01E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.96E-06 1.64E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.12E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 1.27E-07 7.42E-12 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.40E-06 4.88E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 7.71E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 8.65E-08 6.71E-09 mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 2.02E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 4.50E-08 8.86E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.99E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 1.12E-06 9.98E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 2.61E-07 2.61E-07 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 1.48E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.78E-09 6.40E-13 mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 NA 1.17E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 3.80E-06 NA mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293770 2.91E-07 1.32E-10 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251