RiceVarMap2

Detailed information for vg0408293364:

Variant ID: vg0408293364 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 8293364

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAACTTCGGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCGGATCCTGTTGAGACGAAAGACCATGTAAGATCTGGTCGTGTAAGAGTTCTCGCCGT[G/A]
CGTATTAACCAAGCCGTGTAACCGGAAATAAATTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTGCTGGTTCAACCGAGGCAGGTCAAAGGTCCAAAA

Reverse complement sequence

TTTTGGACCTTTGACCTGCCTCGGTTGAACCAGCACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAATTTATTTCCGGTTACACGGCTTGGTTAATACG[C/T]
ACGGCGAGAACTCTTACACGACCAGATCTTACATGGTCTTTCGTCTCAACAGGATCCGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCCGAAGTTCCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.60%	0.40%	7.83%	68.13%	NA
All Indica	2759	4.90%	0.80%	10.04%	84.27%	NA
All Japonica	1512	63.00%	0.00%	2.78%	34.26%	NA
Aus	269	1.50%	0.00%	13.38%	85.13%	NA
Indica I	595	2.90%	1.30%	3.36%	92.44%	NA
Indica II	465	5.80%	0.20%	15.48%	78.49%	NA
Indica III	913	6.20%	0.50%	11.61%	81.60%	NA
Indica Intermediate	786	4.50%	0.90%	10.05%	84.61%	NA
Temperate Japonica	767	95.80%	0.00%	0.00%	4.17%	NA
Tropical Japonica	504	9.30%	0.00%	7.94%	82.74%	NA
Japonica Intermediate	241	70.50%	0.00%	0.83%	28.63%	NA
VI/Aromatic	96	1.00%	0.00%	9.38%	89.58%	NA
Intermediate	90	24.40%	0.00%	6.67%	68.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408293364	G -> DEL	N	N	silent_mutation	Average:13.097; most accessible tissue: Callus, score: 19.794	N	N	N	N
vg0408293364	G -> A	LOC_Os04g14770.1	downstream_gene_variant ; 688.0bp to feature; MODIFIER	silent_mutation	Average:13.097; most accessible tissue: Callus, score: 19.794	N	N	N	N
vg0408293364	G -> A	LOC_Os04g14780.1	downstream_gene_variant ; 322.0bp to feature; MODIFIER	silent_mutation	Average:13.097; most accessible tissue: Callus, score: 19.794	N	N	N	N
vg0408293364	G -> A	LOC_Os04g14770-LOC_Os04g14780	intergenic_region ; MODIFIER	silent_mutation	Average:13.097; most accessible tissue: Callus, score: 19.794	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408293364	2.67E-06	5.71E-06	mr1116	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408293364	NA	2.89E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0408293364:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact