\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408205825:

Variant ID: vg0408205825 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8205825
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CCACGTGTCGCGAGGGTAGGCGAAACGGTAAATTACCATCGACCGAGCTACACAGTAAAAAGCCCGCAAAGGGAAGGCCCATTACTGTTCCTTTCTGCCC[A/G]
GGAAAAATAAAAAATATATATGCCACCCTCCGAAGGAGGCGAAGAGCAGCAAAATAATATCAGCCGCACAGATAACAAACTTTATTTGTAGGAACAATGT

Reverse complement sequence

ACATTGTTCCTACAAATAAAGTTTGTTATCTGTGCGGCTGATATTATTTTGCTGCTCTTCGCCTCCTTCGGAGGGTGGCATATATATTTTTTATTTTTCC[T/C]
GGGCAGAAAGGAACAGTAATGGGCCTTCCCTTTGCGGGCTTTTTACTGTGTAGCTCGGTCGATGGTAATTTACCGTTTCGCCTACCCTCGCGACACGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 18.20% 0.17% 7.09% NA
All Indica  2759 92.60% 0.50% 0.18% 6.67% NA
All Japonica  1512 36.30% 54.20% 0.13% 9.33% NA
Aus  269 96.70% 2.20% 0.00% 1.12% NA
Indica I  595 84.20% 0.50% 0.34% 14.96% NA
Indica II  465 95.90% 1.50% 0.00% 2.58% NA
Indica III  913 96.60% 0.20% 0.11% 3.07% NA
Indica Intermediate  786 92.40% 0.40% 0.25% 7.00% NA
Temperate Japonica  767 3.30% 89.60% 0.00% 7.17% NA
Tropical Japonica  504 91.10% 4.00% 0.00% 4.96% NA
Japonica Intermediate  241 27.00% 46.90% 0.83% 25.31% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 70.00% 21.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408205825 A -> DEL N N silent_mutation Average:43.074; most accessible tissue: Callus, score: 54.543 N N N N
vg0408205825 A -> G LOC_Os04g14630.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:43.074; most accessible tissue: Callus, score: 54.543 N N N N
vg0408205825 A -> G LOC_Os04g14640.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:43.074; most accessible tissue: Callus, score: 54.543 N N N N
vg0408205825 A -> G LOC_Os04g14620.1 downstream_gene_variant ; 3289.0bp to feature; MODIFIER silent_mutation Average:43.074; most accessible tissue: Callus, score: 54.543 N N N N
vg0408205825 A -> G LOC_Os04g14630-LOC_Os04g14640 intergenic_region ; MODIFIER silent_mutation Average:43.074; most accessible tissue: Callus, score: 54.543 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408205825 NA 8.23E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 4.65E-18 mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 2.50E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 8.82E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 2.41E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 5.06E-42 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 3.62E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 2.53E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 1.41E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825 NA 2.24E-32 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251