\
| Variant ID: vg0408205825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8205825 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 94. )
CCACGTGTCGCGAGGGTAGGCGAAACGGTAAATTACCATCGACCGAGCTACACAGTAAAAAGCCCGCAAAGGGAAGGCCCATTACTGTTCCTTTCTGCCC[A/G]
GGAAAAATAAAAAATATATATGCCACCCTCCGAAGGAGGCGAAGAGCAGCAAAATAATATCAGCCGCACAGATAACAAACTTTATTTGTAGGAACAATGT
ACATTGTTCCTACAAATAAAGTTTGTTATCTGTGCGGCTGATATTATTTTGCTGCTCTTCGCCTCCTTCGGAGGGTGGCATATATATTTTTTATTTTTCC[T/C]
GGGCAGAAAGGAACAGTAATGGGCCTTCCCTTTGCGGGCTTTTTACTGTGTAGCTCGGTCGATGGTAATTTACCGTTTCGCCTACCCTCGCGACACGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 18.20% | 0.17% | 7.09% | NA |
| All Indica | 2759 | 92.60% | 0.50% | 0.18% | 6.67% | NA |
| All Japonica | 1512 | 36.30% | 54.20% | 0.13% | 9.33% | NA |
| Aus | 269 | 96.70% | 2.20% | 0.00% | 1.12% | NA |
| Indica I | 595 | 84.20% | 0.50% | 0.34% | 14.96% | NA |
| Indica II | 465 | 95.90% | 1.50% | 0.00% | 2.58% | NA |
| Indica III | 913 | 96.60% | 0.20% | 0.11% | 3.07% | NA |
| Indica Intermediate | 786 | 92.40% | 0.40% | 0.25% | 7.00% | NA |
| Temperate Japonica | 767 | 3.30% | 89.60% | 0.00% | 7.17% | NA |
| Tropical Japonica | 504 | 91.10% | 4.00% | 0.00% | 4.96% | NA |
| Japonica Intermediate | 241 | 27.00% | 46.90% | 0.83% | 25.31% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 21.10% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408205825 | A -> DEL | N | N | silent_mutation | Average:43.074; most accessible tissue: Callus, score: 54.543 | N | N | N | N |
| vg0408205825 | A -> G | LOC_Os04g14630.1 | upstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:43.074; most accessible tissue: Callus, score: 54.543 | N | N | N | N |
| vg0408205825 | A -> G | LOC_Os04g14640.1 | upstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:43.074; most accessible tissue: Callus, score: 54.543 | N | N | N | N |
| vg0408205825 | A -> G | LOC_Os04g14620.1 | downstream_gene_variant ; 3289.0bp to feature; MODIFIER | silent_mutation | Average:43.074; most accessible tissue: Callus, score: 54.543 | N | N | N | N |
| vg0408205825 | A -> G | LOC_Os04g14630-LOC_Os04g14640 | intergenic_region ; MODIFIER | silent_mutation | Average:43.074; most accessible tissue: Callus, score: 54.543 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408205825 | NA | 8.23E-35 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 4.65E-18 | mr1401 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 2.50E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 8.82E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 2.41E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 5.06E-42 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 3.62E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 2.53E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 1.41E-31 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408205825 | NA | 2.24E-32 | mr1368_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |