Search for Variation information by Variation ID:
Detailed information for vg0408189091:
| Variant ID: vg0408189091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8189091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 107. )
Flanking Sequence (100 bp) in Reference Genome:
CAAGTATGAGTTGCAGCCCATTGCACCAATCTGGCCTTTCGCCAGATGGGGACTGGACATCATTGGACCGTTCCCGGTGGCGCGAAACGGGTACATGTTC[G/A]
CAATTGTGGCGGCCGTCGAATACTTCTCTCGATGGATTGAGGCCGAGCCCCTCGGAGCGATCACTTCGACAGCAGTACAAAAGTTCGTATGGAAAAACAT
Reverse complement sequence
ATGTTTTTCCATACGAACTTTTGTACTGCTGTCGAAGTGATCGCTCCGAGGGGCTCGGCCTCAATCCATCGAGAGAAGTATTCGACGGCCGCCACAATTG[C/T]
GAACATGTACCCGTTTCGCGCCACCGGGAACGGTCCAATGATGTCCAGTCCCCATCTGGCGAAAGGCCAGATTGGTGCAATGGGCTGCAACTCATACTTG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 31.00% | 8.63% | 27.68% | NA |
| All Indica | 2759 | 52.70% | 15.20% | 14.46% | 17.69% | NA |
| All Japonica | 1512 | 1.90% | 64.50% | 0.13% | 33.47% | NA |
| Aus | 269 | 13.40% | 13.00% | 1.49% | 72.12% | NA |
| Indica I | 595 | 46.70% | 25.00% | 15.80% | 12.44% | NA |
| Indica II | 465 | 30.10% | 29.50% | 10.97% | 29.46% | NA |
| Indica III | 913 | 66.80% | 3.40% | 16.32% | 13.47% | NA |
| Indica Intermediate | 786 | 54.10% | 13.00% | 13.36% | 19.59% | NA |
| Temperate Japonica | 767 | 0.40% | 96.20% | 0.00% | 3.39% | NA |
| Tropical Japonica | 504 | 4.00% | 13.30% | 0.40% | 82.34% | NA |
| Japonica Intermediate | 241 | 2.50% | 70.50% | 0.00% | 26.97% | NA |
| VI/Aromatic | 96 | 9.40% | 8.30% | 0.00% | 82.29% | NA |
| Intermediate | 90 | 17.80% | 33.30% | 3.33% | 45.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408189091 | G -> DEL | LOC_Os04g14590.1 | N | frameshift_variant | Average:24.624; most accessible tissue: Minghui63 young leaf, score: 35.334 | N | N | N | N |
| vg0408189091 | G -> A | LOC_Os04g14590.1 | missense_variant ; p.Ala620Thr; MODERATE | nonsynonymous_codon ; A620T | Average:24.624; most accessible tissue: Minghui63 young leaf, score: 35.334 | benign  |
0.105 |
TOLERATED | 0.16 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408189091 | NA | 5.43E-17 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 6.55E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 3.59E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 3.19E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 1.36E-22 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | 4.47E-06 | 2.78E-22 | mr1836_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 2.77E-06 | mr1836_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 5.13E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408189091 | NA | 5.13E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |