\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408147564:

Variant ID: vg0408147564 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8147564
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCACTGGACTGCCCACCATCGCCCTTAGACGCAGCGTCCTTTTCCCGAGCTTTCTCCTCAACATCAAGAGACGCTATCAACCCCTCAACGGAGTATTC[C/A]
TGTCTCTTGTGTTTGAGTGCAGTACCGATCTCCAAGATGGAGGTAGTTTCGCAATAATGCACCCGGCCACAAATTTGTCGGGTAAGACACATTTAAGGAG

Reverse complement sequence

CTCCTTAAATGTGTCTTACCCGACAAATTTGTGGCCGGGTGCATTATTGCGAAACTACCTCCATCTTGGAGATCGGTACTGCACTCAAACACAAGAGACA[G/T]
GAATACTCCGTTGAGGGGTTGATAGCGTCTCTTGATGTTGAGGAGAAAGCTCGGGAAAAGGACGCTGCGTCTAAGGGCGATGGTGGGCAGTCCAGTGCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.70% 9.50% 10.22% 49.62% NA
All Indica  2759 15.50% 0.30% 10.15% 74.08% NA
All Japonica  1512 63.80% 27.80% 5.42% 2.98% NA
Aus  269 8.60% 0.00% 22.68% 68.77% NA
Indica I  595 11.40% 0.00% 6.39% 82.18% NA
Indica II  465 29.90% 0.40% 6.45% 63.23% NA
Indica III  913 13.60% 0.10% 15.55% 70.76% NA
Indica Intermediate  786 12.20% 0.60% 8.91% 78.24% NA
Temperate Japonica  767 96.20% 2.50% 0.52% 0.78% NA
Tropical Japonica  504 10.30% 72.20% 12.30% 5.16% NA
Japonica Intermediate  241 72.60% 15.40% 6.64% 5.39% NA
VI/Aromatic  96 3.10% 5.20% 44.79% 46.88% NA
Intermediate  90 34.40% 17.80% 18.89% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408147564 C -> DEL N N silent_mutation Average:7.693; most accessible tissue: Callus, score: 31.566 N N N N
vg0408147564 C -> A LOC_Os04g14550.1 intron_variant ; MODIFIER silent_mutation Average:7.693; most accessible tissue: Callus, score: 31.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408147564 NA 1.42E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 2.25E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 4.36E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 1.75E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 2.25E-06 2.25E-06 mr1424_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 2.81E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 2.84E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 4.94E-06 NA mr1831_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 9.24E-06 9.24E-06 mr1884_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408147564 NA 5.60E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251