\
| Variant ID: vg0408147564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8147564 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGCACTGGACTGCCCACCATCGCCCTTAGACGCAGCGTCCTTTTCCCGAGCTTTCTCCTCAACATCAAGAGACGCTATCAACCCCTCAACGGAGTATTC[C/A]
TGTCTCTTGTGTTTGAGTGCAGTACCGATCTCCAAGATGGAGGTAGTTTCGCAATAATGCACCCGGCCACAAATTTGTCGGGTAAGACACATTTAAGGAG
CTCCTTAAATGTGTCTTACCCGACAAATTTGTGGCCGGGTGCATTATTGCGAAACTACCTCCATCTTGGAGATCGGTACTGCACTCAAACACAAGAGACA[G/T]
GAATACTCCGTTGAGGGGTTGATAGCGTCTCTTGATGTTGAGGAGAAAGCTCGGGAAAAGGACGCTGCGTCTAAGGGCGATGGTGGGCAGTCCAGTGCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.70% | 9.50% | 10.22% | 49.62% | NA |
| All Indica | 2759 | 15.50% | 0.30% | 10.15% | 74.08% | NA |
| All Japonica | 1512 | 63.80% | 27.80% | 5.42% | 2.98% | NA |
| Aus | 269 | 8.60% | 0.00% | 22.68% | 68.77% | NA |
| Indica I | 595 | 11.40% | 0.00% | 6.39% | 82.18% | NA |
| Indica II | 465 | 29.90% | 0.40% | 6.45% | 63.23% | NA |
| Indica III | 913 | 13.60% | 0.10% | 15.55% | 70.76% | NA |
| Indica Intermediate | 786 | 12.20% | 0.60% | 8.91% | 78.24% | NA |
| Temperate Japonica | 767 | 96.20% | 2.50% | 0.52% | 0.78% | NA |
| Tropical Japonica | 504 | 10.30% | 72.20% | 12.30% | 5.16% | NA |
| Japonica Intermediate | 241 | 72.60% | 15.40% | 6.64% | 5.39% | NA |
| VI/Aromatic | 96 | 3.10% | 5.20% | 44.79% | 46.88% | NA |
| Intermediate | 90 | 34.40% | 17.80% | 18.89% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408147564 | C -> DEL | N | N | silent_mutation | Average:7.693; most accessible tissue: Callus, score: 31.566 | N | N | N | N |
| vg0408147564 | C -> A | LOC_Os04g14550.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.693; most accessible tissue: Callus, score: 31.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408147564 | NA | 1.42E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 2.25E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 4.36E-08 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 1.75E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | 2.25E-06 | 2.25E-06 | mr1424_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 2.81E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 2.84E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | 4.94E-06 | NA | mr1831_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | 9.24E-06 | 9.24E-06 | mr1884_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408147564 | NA | 5.60E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |