Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408057944:

Variant ID: vg0408057944 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8057944
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TATTAGACATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGCTTCACTACTACTTAATGATGGACATGATAATGGCTAAT[C/T]
GTGATTGGTTAATTAATTAATGTGCCAACTAAAACTTGATAATGGTGGGTTGTGAGCACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACCGGTT

Reverse complement sequence

AACCGGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGTGCTCACAACCCACCATTATCAAGTTTTAGTTGGCACATTAATTAATTAACCAATCAC[G/A]
ATTAGCCATTATCATGTCCATCATTAAGTAGTAGTGAAGCATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATGTCTAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	9.30%	16.63%	10.54%	NA
All Indica	2759	57.50%	14.10%	25.55%	2.79%	NA
All Japonica	1512	68.60%	1.70%	2.65%	27.05%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	30.80%	14.30%	46.05%	8.91%	NA
Indica II	465	82.40%	4.70%	10.97%	1.94%	NA
Indica III	913	60.00%	18.80%	21.03%	0.11%	NA
Indica Intermediate	786	60.20%	14.10%	23.92%	1.78%	NA
Temperate Japonica	767	96.60%	0.00%	0.65%	2.74%	NA
Tropical Japonica	504	23.20%	4.40%	4.76%	67.66%	NA
Japonica Intermediate	241	74.30%	1.70%	4.56%	19.50%	NA
VI/Aromatic	96	59.40%	11.50%	26.04%	3.12%	NA
Intermediate	90	64.40%	10.00%	15.56%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408057944	C -> DEL	N	N	silent_mutation	Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0408057944	C -> T	LOC_Os04g14390.1	upstream_gene_variant ; 3402.0bp to feature; MODIFIER	silent_mutation	Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0408057944	C -> T	LOC_Os04g14400.1	upstream_gene_variant ; 4369.0bp to feature; MODIFIER	silent_mutation	Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0408057944	C -> T	LOC_Os04g14390-LOC_Os04g14400	intergenic_region ; MODIFIER	silent_mutation	Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408057944	4.16E-06	2.72E-06	mr1404	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	1.01E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	1.92E-07	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	1.56E-07	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	2.57E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	5.50E-07	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	6.19E-09	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	3.08E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	2.54E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	7.21E-08	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	6.53E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	2.54E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944	NA	4.97E-07	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251