\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408057944:

Variant ID: vg0408057944 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8057944
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAGACATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGCTTCACTACTACTTAATGATGGACATGATAATGGCTAAT[C/T]
GTGATTGGTTAATTAATTAATGTGCCAACTAAAACTTGATAATGGTGGGTTGTGAGCACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACCGGTT

Reverse complement sequence

AACCGGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGTGCTCACAACCCACCATTATCAAGTTTTAGTTGGCACATTAATTAATTAACCAATCAC[G/A]
ATTAGCCATTATCATGTCCATCATTAAGTAGTAGTGAAGCATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATGTCTAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 9.30% 16.63% 10.54% NA
All Indica  2759 57.50% 14.10% 25.55% 2.79% NA
All Japonica  1512 68.60% 1.70% 2.65% 27.05% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 30.80% 14.30% 46.05% 8.91% NA
Indica II  465 82.40% 4.70% 10.97% 1.94% NA
Indica III  913 60.00% 18.80% 21.03% 0.11% NA
Indica Intermediate  786 60.20% 14.10% 23.92% 1.78% NA
Temperate Japonica  767 96.60% 0.00% 0.65% 2.74% NA
Tropical Japonica  504 23.20% 4.40% 4.76% 67.66% NA
Japonica Intermediate  241 74.30% 1.70% 4.56% 19.50% NA
VI/Aromatic  96 59.40% 11.50% 26.04% 3.12% NA
Intermediate  90 64.40% 10.00% 15.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408057944 C -> DEL N N silent_mutation Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0408057944 C -> T LOC_Os04g14390.1 upstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0408057944 C -> T LOC_Os04g14400.1 upstream_gene_variant ; 4369.0bp to feature; MODIFIER silent_mutation Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0408057944 C -> T LOC_Os04g14390-LOC_Os04g14400 intergenic_region ; MODIFIER silent_mutation Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408057944 4.16E-06 2.72E-06 mr1404 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 1.01E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 1.92E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 1.56E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 2.57E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 5.50E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 6.19E-09 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 3.08E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 2.54E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 7.21E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 6.53E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 2.54E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057944 NA 4.97E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251