\
| Variant ID: vg0408057944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8057944 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )
TATTAGACATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGCTTCACTACTACTTAATGATGGACATGATAATGGCTAAT[C/T]
GTGATTGGTTAATTAATTAATGTGCCAACTAAAACTTGATAATGGTGGGTTGTGAGCACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACCGGTT
AACCGGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGTGCTCACAACCCACCATTATCAAGTTTTAGTTGGCACATTAATTAATTAACCAATCAC[G/A]
ATTAGCCATTATCATGTCCATCATTAAGTAGTAGTGAAGCATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATGTCTAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 9.30% | 16.63% | 10.54% | NA |
| All Indica | 2759 | 57.50% | 14.10% | 25.55% | 2.79% | NA |
| All Japonica | 1512 | 68.60% | 1.70% | 2.65% | 27.05% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 30.80% | 14.30% | 46.05% | 8.91% | NA |
| Indica II | 465 | 82.40% | 4.70% | 10.97% | 1.94% | NA |
| Indica III | 913 | 60.00% | 18.80% | 21.03% | 0.11% | NA |
| Indica Intermediate | 786 | 60.20% | 14.10% | 23.92% | 1.78% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.65% | 2.74% | NA |
| Tropical Japonica | 504 | 23.20% | 4.40% | 4.76% | 67.66% | NA |
| Japonica Intermediate | 241 | 74.30% | 1.70% | 4.56% | 19.50% | NA |
| VI/Aromatic | 96 | 59.40% | 11.50% | 26.04% | 3.12% | NA |
| Intermediate | 90 | 64.40% | 10.00% | 15.56% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408057944 | C -> DEL | N | N | silent_mutation | Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0408057944 | C -> T | LOC_Os04g14390.1 | upstream_gene_variant ; 3402.0bp to feature; MODIFIER | silent_mutation | Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0408057944 | C -> T | LOC_Os04g14400.1 | upstream_gene_variant ; 4369.0bp to feature; MODIFIER | silent_mutation | Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0408057944 | C -> T | LOC_Os04g14390-LOC_Os04g14400 | intergenic_region ; MODIFIER | silent_mutation | Average:22.893; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408057944 | 4.16E-06 | 2.72E-06 | mr1404 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 1.01E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 1.92E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 1.56E-07 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 2.57E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 5.50E-07 | mr1338_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 6.19E-09 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 3.08E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 2.54E-07 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 7.21E-08 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 6.53E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 2.54E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408057944 | NA | 4.97E-07 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |