\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408057772:

Variant ID: vg0408057772 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8057772
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.05, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTATATTTAAATTCTCTATTTATTTCAACTGTGCATTTATTTTCGAATGTCACCAGGTGGTGTGAACTTATTCCTTTGTTATGGCCTGTTTGCATTG[T/A]
TTACTCTATTCCTTGATACCTTGGGTTATTATAATTTGACTAGTTGAGCTTTATATATTGGTTCAGCTAGATATTAGACATAATTGCTTAGCCATGCTTA

Reverse complement sequence

TAAGCATGGCTAAGCAATTATGTCTAATATCTAGCTGAACCAATATATAAAGCTCAACTAGTCAAATTATAATAACCCAAGGTATCAAGGAATAGAGTAA[A/T]
CAATGCAAACAGGCCATAACAAAGGAATAAGTTCACACCACCTGGTGACATTCGAAAATAAATGCACAGTTGAAATAAATAGAGAATTTAAATATAGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 24.10% 18.41% 17.20% NA
All Indica  2759 55.00% 6.00% 26.46% 12.58% NA
All Japonica  1512 2.60% 62.60% 5.62% 29.23% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 36.80% 1.30% 27.39% 34.45% NA
Indica II  465 33.50% 19.80% 40.22% 6.45% NA
Indica III  913 77.20% 3.80% 15.77% 3.18% NA
Indica Intermediate  786 55.60% 3.80% 30.03% 10.56% NA
Temperate Japonica  767 0.50% 96.10% 0.65% 2.74% NA
Tropical Japonica  504 4.40% 8.30% 13.29% 74.01% NA
Japonica Intermediate  241 5.40% 69.30% 5.39% 19.92% NA
VI/Aromatic  96 50.00% 1.00% 41.67% 7.29% NA
Intermediate  90 38.90% 27.80% 15.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408057772 T -> DEL N N silent_mutation Average:13.596; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0408057772 T -> A LOC_Os04g14390.1 upstream_gene_variant ; 3230.0bp to feature; MODIFIER silent_mutation Average:13.596; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0408057772 T -> A LOC_Os04g14400.1 upstream_gene_variant ; 4541.0bp to feature; MODIFIER silent_mutation Average:13.596; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0408057772 T -> A LOC_Os04g14390-LOC_Os04g14400 intergenic_region ; MODIFIER silent_mutation Average:13.596; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408057772 NA 4.74E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 4.14E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 8.89E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 4.60E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 8.50E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 1.26E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 4.71E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 5.44E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 2.30E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 1.34E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 2.18E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 6.08E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 9.77E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 2.40E-17 mr1540 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 1.90E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 2.28E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 9.62E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 6.41E-18 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 5.31E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 3.86E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 6.21E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 6.88E-13 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057772 NA 1.75E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251