\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408053796:

Variant ID: vg0408053796 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8053796
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAGCATATGGTTTTGATGGTTGTGCTCATGGCAATTAAGGACCGGTTCGCGAGCTACTGTTGTGAGACATTAACCGTACCAACCACAAGCCAGCGTGG[A/G]
CAACGGCTTTATCTTTTGTATAGCCTGATTCATTGCGGGGCACCAGACTGTGAAGCGGCGAGAAGTCCGTGGGGGTCGCTGGGGAGTCCATTGCCTCTGG

Reverse complement sequence

CCAGAGGCAATGGACTCCCCAGCGACCCCCACGGACTTCTCGCCGCTTCACAGTCTGGTGCCCCGCAATGAATCAGGCTATACAAAAGATAAAGCCGTTG[T/C]
CCACGCTGGCTTGTGGTTGGTACGGTTAATGTCTCACAACAGTAGCTCGCGAACCGGTCCTTAATTGCCATGAGCACAACCATCAAAACCATATGCTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 21.00% 35.00% 5.44% NA
All Indica  2759 52.10% 1.40% 45.63% 0.80% NA
All Japonica  1512 1.60% 61.90% 21.69% 14.81% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 32.60% 1.50% 63.70% 2.18% NA
Indica II  465 51.60% 1.70% 45.81% 0.86% NA
Indica III  913 64.80% 0.90% 34.06% 0.22% NA
Indica Intermediate  786 52.40% 1.90% 45.29% 0.38% NA
Temperate Japonica  767 0.40% 96.10% 1.04% 2.48% NA
Tropical Japonica  504 3.20% 6.70% 56.94% 33.13% NA
Japonica Intermediate  241 2.10% 68.50% 13.69% 15.77% NA
VI/Aromatic  96 57.30% 0.00% 34.38% 8.33% NA
Intermediate  90 41.10% 20.00% 35.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408053796 A -> DEL N N silent_mutation Average:33.316; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0408053796 A -> G LOC_Os04g14380.1 downstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:33.316; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0408053796 A -> G LOC_Os04g14390.1 downstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:33.316; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0408053796 A -> G LOC_Os04g14380-LOC_Os04g14390 intergenic_region ; MODIFIER silent_mutation Average:33.316; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408053796 NA 5.66E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.84E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.77E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 2.95E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 5.61E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.76E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.02E-06 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 4.16E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.25E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 8.57E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 3.43E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.56E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.38E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 4.01E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.85E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 9.90E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 8.64E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.54E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.66E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 2.87E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.60E-07 mr1716 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 8.92E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.86E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 5.65E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 4.25E-11 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.17E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 5.80E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.43E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.01E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 1.28E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408053796 NA 6.14E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251