\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408052694:

Variant ID: vg0408052694 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8052694
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGGAGTCCGATCTCTTCAATCCAAGGCTATAAATAGGACCCCCTAGTCCTCCTCTTTCGTTTTCCCCCTGTCCCGTGGTCTCCCGTGTCCCGTAGCCT[T/C]
GCCGCCACCGCCGCCTAGCTCACCGGTTGCCGCCGGCCATCTCCGGCGAGGTAGCGCCGCCACCTCCGTCGTCGTCGCCGCTTGCCGCCGCCGCGTTTAG

Reverse complement sequence

CTAAACGCGGCGGCGGCAAGCGGCGACGACGACGGAGGTGGCGGCGCTACCTCGCCGGAGATGGCCGGCGGCAACCGGTGAGCTAGGCGGCGGTGGCGGC[A/G]
AGGCTACGGGACACGGGAGACCACGGGACAGGGGGAAAACGAAAGAGGAGGACTAGGGGGTCCTATTTATAGCCTTGGATTGAAGAGATCGGACTCCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.40% 19.20% 47.76% 2.69% NA
All Indica  2759 15.20% 10.90% 72.67% 1.27% NA
All Japonica  1512 46.50% 36.50% 11.04% 5.95% NA
Aus  269 90.30% 4.10% 5.20% 0.37% NA
Indica I  595 3.40% 8.40% 87.23% 1.01% NA
Indica II  465 24.10% 12.50% 61.72% 1.72% NA
Indica III  913 17.90% 9.70% 72.18% 0.22% NA
Indica Intermediate  786 15.80% 13.10% 68.70% 2.42% NA
Temperate Japonica  767 71.60% 3.70% 17.34% 7.43% NA
Tropical Japonica  504 5.20% 90.30% 2.98% 1.59% NA
Japonica Intermediate  241 53.10% 28.60% 7.88% 10.37% NA
VI/Aromatic  96 44.80% 22.90% 32.29% 0.00% NA
Intermediate  90 31.10% 23.30% 44.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408052694 T -> C LOC_Os04g14380.1 downstream_gene_variant ; 1745.0bp to feature; MODIFIER silent_mutation Average:63.089; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0408052694 T -> C LOC_Os04g14390.1 downstream_gene_variant ; 1615.0bp to feature; MODIFIER silent_mutation Average:63.089; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0408052694 T -> C LOC_Os04g14380-LOC_Os04g14390 intergenic_region ; MODIFIER silent_mutation Average:63.089; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0408052694 T -> DEL N N silent_mutation Average:63.089; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408052694 NA 2.43E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.68E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.19E-07 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 3.99E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.16E-10 mr1206 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.00E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 4.99E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 5.39E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 6.99E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.02E-10 mr1403 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 9.13E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 6.48E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 1.10E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 3.03E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 5.52E-08 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 2.08E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408052694 NA 5.78E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251