Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408046336:

Variant ID: vg0408046336 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8046336
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTACATACTATTTAAATTTAAATTATCATAAACCACATTAATTTACTTAATCTGATGTTATCTATCTATCTTACACGTTATTTTTTATTGTTATCATA[C/T]
TAAATTCCCGCAGCAATGCGCGGGGTTTTACCTAGTTATATAAAGTTTACTCTACTAAAGAATTAGTAGTGCCAAAATTTACTTACAGTTTAGTACTACC

Reverse complement sequence

GGTAGTACTAAACTGTAAGTAAATTTTGGCACTACTAATTCTTTAGTAGAGTAAACTTTATATAACTAGGTAAAACCCCGCGCATTGCTGCGGGAATTTA[G/A]
TATGATAACAATAAAAAATAACGTGTAAGATAGATAGATAACATCAGATTAAGTAAATTAATGTGGTTTATGATAATTTAAATTTAAATAGTATGTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	37.00%	0.04%	0.47%	NA
All Indica	2759	93.10%	6.00%	0.07%	0.80%	NA
All Japonica	1512	1.50%	98.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	75.70%	20.60%	0.22%	3.44%	NA
Indica III	913	96.40%	3.50%	0.00%	0.11%	NA
Indica Intermediate	786	95.00%	4.20%	0.13%	0.64%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408046336	C -> DEL	N	N	silent_mutation	Average:38.422; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0408046336	C -> T	LOC_Os04g14360.1	upstream_gene_variant ; 4060.0bp to feature; MODIFIER	silent_mutation	Average:38.422; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0408046336	C -> T	LOC_Os04g14380.1	upstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:38.422; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0408046336	C -> T	LOC_Os04g14370.1	intron_variant ; MODIFIER	silent_mutation	Average:38.422; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408046336	NA	1.32E-89	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	3.37E-80	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	3.28E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	2.16E-06	2.16E-06	mr1836	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	1.95E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	1.34E-103	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	1.32E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408046336	NA	8.07E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251