\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407996034:

Variant ID: vg0407996034 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7996034
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGAAAAGAACATCCACTGCTGCAAAATTCATGCTAAGATCCTCTATTGATGCTAAGATTCACTGCACCAAAATCATGTATATAAAATCTAGCCTCTA[C/T]
ATTCATCCAAAACATCCACAGACAACAAATCACATTTAATTCATCTATACAGCAGCACCAACAATCGAAACAACAAATCACATTTCATTCATCTAAACAA

Reverse complement sequence

TTGTTTAGATGAATGAAATGTGATTTGTTGTTTCGATTGTTGGTGCTGCTGTATAGATGAATTAAATGTGATTTGTTGTCTGTGGATGTTTTGGATGAAT[G/A]
TAGAGGCTAGATTTTATATACATGATTTTGGTGCAGTGAATCTTAGCATCAATAGAGGATCTTAGCATGAATTTTGCAGCAGTGGATGTTCTTTTCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 19.60% 10.50% 6.03% NA
All Indica  2759 47.60% 29.90% 14.82% 7.72% NA
All Japonica  1512 89.00% 4.40% 2.38% 4.30% NA
Aus  269 93.70% 0.40% 4.83% 1.12% NA
Indica I  595 41.00% 22.20% 18.15% 18.66% NA
Indica II  465 61.90% 9.70% 21.08% 7.31% NA
Indica III  913 40.20% 50.90% 8.43% 0.44% NA
Indica Intermediate  786 52.70% 23.20% 16.03% 8.14% NA
Temperate Japonica  767 98.30% 0.40% 0.52% 0.78% NA
Tropical Japonica  504 79.60% 10.70% 4.56% 5.16% NA
Japonica Intermediate  241 78.80% 3.70% 3.73% 13.69% NA
VI/Aromatic  96 49.00% 24.00% 26.04% 1.04% NA
Intermediate  90 71.10% 11.10% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407996034 C -> DEL N N silent_mutation Average:14.273; most accessible tissue: Callus, score: 23.126 N N N N
vg0407996034 C -> T LOC_Os04g14260.1 upstream_gene_variant ; 2731.0bp to feature; MODIFIER silent_mutation Average:14.273; most accessible tissue: Callus, score: 23.126 N N N N
vg0407996034 C -> T LOC_Os04g14270.1 upstream_gene_variant ; 129.0bp to feature; MODIFIER silent_mutation Average:14.273; most accessible tissue: Callus, score: 23.126 N N N N
vg0407996034 C -> T LOC_Os04g14280.1 downstream_gene_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:14.273; most accessible tissue: Callus, score: 23.126 N N N N
vg0407996034 C -> T LOC_Os04g14260-LOC_Os04g14270 intergenic_region ; MODIFIER silent_mutation Average:14.273; most accessible tissue: Callus, score: 23.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407996034 NA 3.88E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034 1.12E-06 1.12E-06 mr1159 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034 1.85E-06 1.85E-06 mr1736 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034 NA 9.12E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034 NA 1.26E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251