Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407996034:

Variant ID: vg0407996034 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7996034
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGAAAAGAACATCCACTGCTGCAAAATTCATGCTAAGATCCTCTATTGATGCTAAGATTCACTGCACCAAAATCATGTATATAAAATCTAGCCTCTA[C/T]
ATTCATCCAAAACATCCACAGACAACAAATCACATTTAATTCATCTATACAGCAGCACCAACAATCGAAACAACAAATCACATTTCATTCATCTAAACAA

Reverse complement sequence

TTGTTTAGATGAATGAAATGTGATTTGTTGTTTCGATTGTTGGTGCTGCTGTATAGATGAATTAAATGTGATTTGTTGTCTGTGGATGTTTTGGATGAAT[G/A]
TAGAGGCTAGATTTTATATACATGATTTTGGTGCAGTGAATCTTAGCATCAATAGAGGATCTTAGCATGAATTTTGCAGCAGTGGATGTTCTTTTCTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	19.60%	10.50%	6.03%	NA
All Indica	2759	47.60%	29.90%	14.82%	7.72%	NA
All Japonica	1512	89.00%	4.40%	2.38%	4.30%	NA
Aus	269	93.70%	0.40%	4.83%	1.12%	NA
Indica I	595	41.00%	22.20%	18.15%	18.66%	NA
Indica II	465	61.90%	9.70%	21.08%	7.31%	NA
Indica III	913	40.20%	50.90%	8.43%	0.44%	NA
Indica Intermediate	786	52.70%	23.20%	16.03%	8.14%	NA
Temperate Japonica	767	98.30%	0.40%	0.52%	0.78%	NA
Tropical Japonica	504	79.60%	10.70%	4.56%	5.16%	NA
Japonica Intermediate	241	78.80%	3.70%	3.73%	13.69%	NA
VI/Aromatic	96	49.00%	24.00%	26.04%	1.04%	NA
Intermediate	90	71.10%	11.10%	14.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407996034	C -> DEL	N	N	silent_mutation	Average:14.273; most accessible tissue: Callus, score: 23.126	N	N	N	N
vg0407996034	C -> T	LOC_Os04g14260.1	upstream_gene_variant ; 2731.0bp to feature; MODIFIER	silent_mutation	Average:14.273; most accessible tissue: Callus, score: 23.126	N	N	N	N
vg0407996034	C -> T	LOC_Os04g14270.1	upstream_gene_variant ; 129.0bp to feature; MODIFIER	silent_mutation	Average:14.273; most accessible tissue: Callus, score: 23.126	N	N	N	N
vg0407996034	C -> T	LOC_Os04g14280.1	downstream_gene_variant ; 1357.0bp to feature; MODIFIER	silent_mutation	Average:14.273; most accessible tissue: Callus, score: 23.126	N	N	N	N
vg0407996034	C -> T	LOC_Os04g14260-LOC_Os04g14270	intergenic_region ; MODIFIER	silent_mutation	Average:14.273; most accessible tissue: Callus, score: 23.126	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407996034	NA	3.88E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034	1.12E-06	1.12E-06	mr1159	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034	1.85E-06	1.85E-06	mr1736	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034	NA	9.12E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407996034	NA	1.26E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251