| Variant ID: vg0407996034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7996034 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )
TAAAGAAAAGAACATCCACTGCTGCAAAATTCATGCTAAGATCCTCTATTGATGCTAAGATTCACTGCACCAAAATCATGTATATAAAATCTAGCCTCTA[C/T]
ATTCATCCAAAACATCCACAGACAACAAATCACATTTAATTCATCTATACAGCAGCACCAACAATCGAAACAACAAATCACATTTCATTCATCTAAACAA
TTGTTTAGATGAATGAAATGTGATTTGTTGTTTCGATTGTTGGTGCTGCTGTATAGATGAATTAAATGTGATTTGTTGTCTGTGGATGTTTTGGATGAAT[G/A]
TAGAGGCTAGATTTTATATACATGATTTTGGTGCAGTGAATCTTAGCATCAATAGAGGATCTTAGCATGAATTTTGCAGCAGTGGATGTTCTTTTCTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 19.60% | 10.50% | 6.03% | NA |
| All Indica | 2759 | 47.60% | 29.90% | 14.82% | 7.72% | NA |
| All Japonica | 1512 | 89.00% | 4.40% | 2.38% | 4.30% | NA |
| Aus | 269 | 93.70% | 0.40% | 4.83% | 1.12% | NA |
| Indica I | 595 | 41.00% | 22.20% | 18.15% | 18.66% | NA |
| Indica II | 465 | 61.90% | 9.70% | 21.08% | 7.31% | NA |
| Indica III | 913 | 40.20% | 50.90% | 8.43% | 0.44% | NA |
| Indica Intermediate | 786 | 52.70% | 23.20% | 16.03% | 8.14% | NA |
| Temperate Japonica | 767 | 98.30% | 0.40% | 0.52% | 0.78% | NA |
| Tropical Japonica | 504 | 79.60% | 10.70% | 4.56% | 5.16% | NA |
| Japonica Intermediate | 241 | 78.80% | 3.70% | 3.73% | 13.69% | NA |
| VI/Aromatic | 96 | 49.00% | 24.00% | 26.04% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 11.10% | 14.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407996034 | C -> DEL | N | N | silent_mutation | Average:14.273; most accessible tissue: Callus, score: 23.126 | N | N | N | N |
| vg0407996034 | C -> T | LOC_Os04g14260.1 | upstream_gene_variant ; 2731.0bp to feature; MODIFIER | silent_mutation | Average:14.273; most accessible tissue: Callus, score: 23.126 | N | N | N | N |
| vg0407996034 | C -> T | LOC_Os04g14270.1 | upstream_gene_variant ; 129.0bp to feature; MODIFIER | silent_mutation | Average:14.273; most accessible tissue: Callus, score: 23.126 | N | N | N | N |
| vg0407996034 | C -> T | LOC_Os04g14280.1 | downstream_gene_variant ; 1357.0bp to feature; MODIFIER | silent_mutation | Average:14.273; most accessible tissue: Callus, score: 23.126 | N | N | N | N |
| vg0407996034 | C -> T | LOC_Os04g14260-LOC_Os04g14270 | intergenic_region ; MODIFIER | silent_mutation | Average:14.273; most accessible tissue: Callus, score: 23.126 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407996034 | NA | 3.88E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407996034 | 1.12E-06 | 1.12E-06 | mr1159 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407996034 | 1.85E-06 | 1.85E-06 | mr1736 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407996034 | NA | 9.12E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407996034 | NA | 1.26E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |