Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407876407:

Variant ID: vg0407876407 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7876407
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGAAGTGCGCGGGGGGTTGGCAGGGGAGACGCCGAAACGGAGCCGTGACGAGCGATCGGCATGCGGAAGAGAGGCGGAGCTGATCTTGATCGTTCAAT[T/C]
GGGGTAGAGATATATGAGCCGTTGGATTTGATGAATGAGTAATGTAGGTGTAAGAGTGAGTTGATGAATCTACCCTATAGTTGAACAAATGGTTTTACTC

Reverse complement sequence

GAGTAAAACCATTTGTTCAACTATAGGGTAGATTCATCAACTCACTCTTACACCTACATTACTCATTCATCAAATCCAACGGCTCATATATCTCTACCCC[A/G]
ATTGAACGATCAAGATCAGCTCCGCCTCTCTTCCGCATGCCGATCGCTCGTCACGGCTCCGTTTCGGCGTCTCCCCTGCCAACCCCCCGCGCACTTCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.30% 0.15% 0.00% NA
All Indica  2759 93.40% 6.50% 0.14% 0.00% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 3.50% 0.50% 0.00% NA
Indica II  465 76.10% 23.90% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 51.00% 1.04% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407876407 T -> C LOC_Os04g14100-LOC_Os04g14110 intergenic_region ; MODIFIER silent_mutation Average:98.854; most accessible tissue: Minghui63 root, score: 99.739 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407876407 T C 0.06 0.08 0.04 0.05 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407876407 NA 2.61E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 1.92E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 9.03E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 1.24E-79 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 3.30E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 4.97E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 3.94E-60 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.14E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 3.42E-76 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.76E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 9.08E-80 mr1934 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.94E-55 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 4.06E-104 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 1.51E-101 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 4.31E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 4.68E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 1.14E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 6.64E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 4.03E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.28E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 5.05E-121 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.20E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 6.72E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 5.29E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407876407 NA 2.44E-120 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251