Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407832314:

Variant ID: vg0407832314 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7832314
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGAGGTCTTGAAACTCCTGCATGCCTGTCACGCCCGGAATTTCTATCCAAAATTCCGAACGCTTACATGTGTGTTAAACCCTCGTCCAGGAATCAAC[T/C]
GAGGCACACAATAACAAATTGATAATAGAGTACAAATAAAAAACTATTTAATACTAGCAAATAATAAATTATTACAGAGGTGGATAGTTCCTCTCAAAGA

Reverse complement sequence

TCTTTGAGAGGAACTATCCACCTCTGTAATAATTTATTATTTGCTAGTATTAAATAGTTTTTTATTTGTACTCTATTATCAATTTGTTATTGTGTGCCTC[A/G]
GTTGATTCCTGGACGAGGGTTTAACACACATGTAAGCGTTCGGAATTTTGGATAGAAATTCCGGGCGTGACAGGCATGCAGGAGTTTCAAGACCTCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.40%	17.60%	38.38%	5.63%	NA
All Indica	2759	7.70%	28.30%	57.85%	6.13%	NA
All Japonica	1512	98.60%	0.50%	0.66%	0.26%	NA
Aus	269	3.30%	8.60%	54.65%	33.46%	NA
Indica I	595	9.70%	6.90%	80.00%	3.36%	NA
Indica II	465	9.70%	20.60%	56.99%	12.69%	NA
Indica III	913	3.20%	46.80%	44.69%	5.37%	NA
Indica Intermediate	786	10.20%	27.70%	56.87%	5.22%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	97.40%	1.00%	0.99%	0.60%	NA
Japonica Intermediate	241	97.90%	0.00%	1.66%	0.41%	NA
VI/Aromatic	96	55.20%	8.30%	35.42%	1.04%	NA
Intermediate	90	54.40%	13.30%	30.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407832314	T -> C	LOC_Os04g14020.1	upstream_gene_variant ; 3298.0bp to feature; MODIFIER	silent_mutation	Average:18.333; most accessible tissue: Callus, score: 39.819	N	N	N	N
vg0407832314	T -> C	LOC_Os04g14040.1	upstream_gene_variant ; 1646.0bp to feature; MODIFIER	silent_mutation	Average:18.333; most accessible tissue: Callus, score: 39.819	N	N	N	N
vg0407832314	T -> C	LOC_Os04g14020-LOC_Os04g14040	intergenic_region ; MODIFIER	silent_mutation	Average:18.333; most accessible tissue: Callus, score: 39.819	N	N	N	N
vg0407832314	T -> DEL	N	N	silent_mutation	Average:18.333; most accessible tissue: Callus, score: 39.819	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407832314	NA	5.78E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	9.56E-07	1.37E-06	mr1057	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	2.96E-80	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.16E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.67E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	2.76E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.57E-26	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.92E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	6.12E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	2.04E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	9.33E-07	9.47E-07	mr1821	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	8.97E-12	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	4.38E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	5.55E-63	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.54E-18	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	5.38E-46	mr1546_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	1.30E-34	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	4.95E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	9.79E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407832314	NA	5.33E-33	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251