Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407830709:

Variant ID: vg0407830709 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7830709
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GATCATCCTCTCGAGAGACGAGAAGGAGTAAACCCCAGAAAACCATTACGGCCAGTAACGGGAAGCCATCTTTGGGAAGACAATAGATGGTGAACAGAAC[C/T]
GTTGCTGTGTAATAAATACTGGAATTAAAACTGGATTAGTCTATGCTAGATAATAAGCTTGTGAAAGGAATTGTGAAACTAGCTTTATGCAAATAAACCA

Reverse complement sequence

TGGTTTATTTGCATAAAGCTAGTTTCACAATTCCTTTCACAAGCTTATTATCTAGCATAGACTAATCCAGTTTTAATTCCAGTATTTATTACACAGCAAC[G/A]
GTTCTGTTCACCATCTATTGTCTTCCCAAAGATGGCTTCCCGTTACTGGCCGTAATGGTTTTCTGGGGTTTACTCCTTCTCGTCTCTCGAGAGGATGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	0.70%	13.14%	11.02%	NA
All Indica	2759	58.30%	1.10%	22.18%	18.41%	NA
All Japonica	1512	99.30%	0.00%	0.20%	0.46%	NA
Aus	269	98.50%	0.40%	0.37%	0.74%	NA
Indica I	595	95.00%	0.00%	1.18%	3.87%	NA
Indica II	465	39.40%	0.90%	21.08%	38.71%	NA
Indica III	913	39.40%	2.30%	40.31%	17.96%	NA
Indica Intermediate	786	63.60%	0.80%	17.68%	17.94%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	0.00%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407830709	C -> DEL	N	N	silent_mutation	Average:24.842; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0407830709	C -> T	LOC_Os04g14020.1	upstream_gene_variant ; 1693.0bp to feature; MODIFIER	silent_mutation	Average:24.842; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0407830709	C -> T	LOC_Os04g14040.1	upstream_gene_variant ; 3251.0bp to feature; MODIFIER	silent_mutation	Average:24.842; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0407830709	C -> T	LOC_Os04g14010.1	downstream_gene_variant ; 4370.0bp to feature; MODIFIER	silent_mutation	Average:24.842; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0407830709	C -> T	LOC_Os04g14020-LOC_Os04g14040	intergenic_region ; MODIFIER	silent_mutation	Average:24.842; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407830709	1.17E-07	1.97E-11	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	2.96E-06	4.56E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	3.52E-07	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	1.80E-10	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	1.06E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.13E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	6.49E-08	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	4.38E-07	2.57E-10	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	5.14E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	1.08E-06	1.10E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	1.17E-06	4.33E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	1.57E-07	4.17E-09	mr1917	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.61E-08	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	5.19E-10	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	1.91E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	7.57E-11	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	6.06E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.09E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.79E-08	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	4.39E-06	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.74E-13	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407830709	NA	2.74E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251