Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407826844:

Variant ID: vg0407826844 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7826844
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGGGAAGTAGCCTATCAGTTAGCACTGCCAGAAAATATTTCCGATGTACACCCTGTGTTTCATGTGTCACAGCTAAAAAAGTGTTTGCGAGTACCGGA[G/A]
GAGCAAACCCCATTGGGAGATATTCATATTAGTAGTGATCTCACCTACCCGGAGCATCCGGTGAAAGTATTAGATGAGGCTGAGAAGAGAACCCGGACCA

Reverse complement sequence

TGGTCCGGGTTCTCTTCTCAGCCTCATCTAATACTTTCACCGGATGCTCCGGGTAGGTGAGATCACTACTAATATGAATATCTCCCAATGGGGTTTGCTC[C/T]
TCCGGTACTCGCAAACACTTTTTTAGCTGTGACACATGAAACACAGGGTGTACATCGGAAATATTTTCTGGCAGTGCTAACTGATAGGCTACTTCCCCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.90%	27.90%	6.90%	28.25%	NA
All Indica	2759	8.20%	39.40%	9.82%	42.59%	NA
All Japonica	1512	93.80%	0.90%	1.39%	3.97%	NA
Aus	269	0.00%	68.00%	9.29%	22.68%	NA
Indica I	595	7.90%	38.00%	17.65%	36.47%	NA
Indica II	465	12.90%	38.70%	6.88%	41.51%	NA
Indica III	913	2.10%	43.90%	6.13%	47.86%	NA
Indica Intermediate	786	12.80%	35.50%	9.92%	41.73%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	85.30%	1.40%	3.57%	9.72%	NA
Japonica Intermediate	241	92.90%	1.70%	1.24%	4.15%	NA
VI/Aromatic	96	53.10%	24.00%	6.25%	16.67%	NA
Intermediate	90	54.40%	16.70%	3.33%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407826844	G -> DEL	N	N	silent_mutation	Average:51.136; most accessible tissue: Minghui63 young leaf, score: 81.798	N	N	N	N
vg0407826844	G -> A	LOC_Os04g14000.1	downstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Minghui63 young leaf, score: 81.798	N	N	N	N
vg0407826844	G -> A	LOC_Os04g14010.1	downstream_gene_variant ; 505.0bp to feature; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Minghui63 young leaf, score: 81.798	N	N	N	N
vg0407826844	G -> A	LOC_Os04g14020.1	downstream_gene_variant ; 1042.0bp to feature; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Minghui63 young leaf, score: 81.798	N	N	N	N
vg0407826844	G -> A	LOC_Os04g14010-LOC_Os04g14020	intergenic_region ; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Minghui63 young leaf, score: 81.798	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407826844	NA	1.03E-46	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	8.42E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	3.33E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.74E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	6.43E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.72E-45	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.72E-19	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	3.01E-18	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	5.63E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	3.06E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	2.04E-07	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	9.01E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	2.20E-19	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	8.89E-25	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	8.46E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	3.10E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	1.78E-07	2.29E-48	mr1161_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.03E-22	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	2.88E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	2.01E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	6.08E-25	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	5.74E-22	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.04E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.83E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407826844	NA	1.47E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251