| Variant ID: vg0407826743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7826743 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 100. )
CGTATACTTAAAAGTGTCCCCGCTGCGAGGAACCAAGAGGTTCAAGGTCAAAGGGAAACTTGCGCCGAGATATGTGGGACCATTTCCAATAATTGCCAGG[C/T]
GAGGGGAAGTAGCCTATCAGTTAGCACTGCCAGAAAATATTTCCGATGTACACCCTGTGTTTCATGTGTCACAGCTAAAAAAGTGTTTGCGAGTACCGGA
TCCGGTACTCGCAAACACTTTTTTAGCTGTGACACATGAAACACAGGGTGTACATCGGAAATATTTTCTGGCAGTGCTAACTGATAGGCTACTTCCCCTC[G/A]
CCTGGCAATTATTGGAAATGGTCCCACATATCTCGGCGCAAGTTTCCCTTTGACCTTGAACCTCTTGGTTCCTCGCAGCGGGGACACTTTTAAGTATACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 13.60% | 1.02% | 16.93% | NA |
| All Indica | 2759 | 52.00% | 22.80% | 1.34% | 23.89% | NA |
| All Japonica | 1512 | 92.10% | 0.30% | 0.33% | 7.34% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.00% | 0.74% | NA |
| Indica I | 595 | 93.60% | 1.20% | 0.00% | 5.21% | NA |
| Indica II | 465 | 46.70% | 20.60% | 3.01% | 29.68% | NA |
| Indica III | 913 | 24.80% | 41.60% | 0.99% | 32.64% | NA |
| Indica Intermediate | 786 | 55.20% | 18.60% | 1.78% | 24.43% | NA |
| Temperate Japonica | 767 | 97.40% | 0.10% | 0.13% | 2.35% | NA |
| Tropical Japonica | 504 | 87.10% | 0.40% | 0.60% | 11.90% | NA |
| Japonica Intermediate | 241 | 85.50% | 0.40% | 0.41% | 13.69% | NA |
| VI/Aromatic | 96 | 83.30% | 1.00% | 3.12% | 12.50% | NA |
| Intermediate | 90 | 74.40% | 4.40% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407826743 | C -> DEL | N | N | silent_mutation | Average:41.048; most accessible tissue: Callus, score: 82.963 | N | N | N | N |
| vg0407826743 | C -> T | LOC_Os04g14000.1 | downstream_gene_variant ; 1547.0bp to feature; MODIFIER | silent_mutation | Average:41.048; most accessible tissue: Callus, score: 82.963 | N | N | N | N |
| vg0407826743 | C -> T | LOC_Os04g14010.1 | downstream_gene_variant ; 404.0bp to feature; MODIFIER | silent_mutation | Average:41.048; most accessible tissue: Callus, score: 82.963 | N | N | N | N |
| vg0407826743 | C -> T | LOC_Os04g14020.1 | downstream_gene_variant ; 1143.0bp to feature; MODIFIER | silent_mutation | Average:41.048; most accessible tissue: Callus, score: 82.963 | N | N | N | N |
| vg0407826743 | C -> T | LOC_Os04g14010-LOC_Os04g14020 | intergenic_region ; MODIFIER | silent_mutation | Average:41.048; most accessible tissue: Callus, score: 82.963 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407826743 | NA | 2.29E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0407826743 | 6.08E-07 | NA | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | NA | 1.53E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 5.17E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 1.12E-07 | 2.48E-12 | mr1113 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 1.16E-07 | 9.40E-12 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 6.29E-07 | 1.51E-11 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 6.13E-07 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 1.96E-10 | 8.77E-22 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407826743 | 8.96E-06 | 1.16E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/