\
| Variant ID: vg0407825796 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7825796 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )
CGGGATTTGCCAAAGAATTTTCAATCAATGAGAACGGAATCCTGTGGTATAAAAAGAGGATTTATATGCCTGAACAGGGTGATTTGAGAAAGTTAATTCT[C/G]
AAGGAAGCACATGAATTTGCATATTCACTGCATCCTGGCAGCACAAAGATGTACCAGGATTTGAAAGAGGCGTATTGGTGGCCCAACATGAAAAGGGATG
CATCCCTTTTCATGTTGGGCCACCAATACGCCTCTTTCAAATCCTGGTACATCTTTGTGCTGCCAGGATGCAGTGAATATGCAAATTCATGTGCTTCCTT[G/C]
AGAATTAACTTTCTCAAATCACCCTGTTCAGGCATATAAATCCTCTTTTTATACCACAGGATTCCGTTCTCATTGATTGAAAATTCTTTGGCAAATCCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 14.80% | 0.66% | 17.16% | NA |
| All Indica | 2759 | 51.00% | 24.90% | 1.01% | 23.16% | NA |
| All Japonica | 1512 | 90.10% | 0.40% | 0.13% | 9.33% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.00% | 0.74% | NA |
| Indica I | 595 | 93.40% | 1.30% | 0.17% | 5.04% | NA |
| Indica II | 465 | 46.20% | 22.40% | 2.37% | 29.03% | NA |
| Indica III | 913 | 22.50% | 45.00% | 0.55% | 31.98% | NA |
| Indica Intermediate | 786 | 54.70% | 20.70% | 1.40% | 23.16% | NA |
| Temperate Japonica | 767 | 97.00% | 0.30% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 83.10% | 0.40% | 0.40% | 16.07% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.80% | 0.00% | 16.18% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 74.40% | 5.60% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407825796 | C -> DEL | N | N | silent_mutation | Average:49.279; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0407825796 | C -> G | LOC_Os04g14010.1 | upstream_gene_variant ; 217.0bp to feature; MODIFIER | silent_mutation | Average:49.279; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0407825796 | C -> G | LOC_Os04g14000.1 | downstream_gene_variant ; 600.0bp to feature; MODIFIER | silent_mutation | Average:49.279; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0407825796 | C -> G | LOC_Os04g14020.1 | downstream_gene_variant ; 2090.0bp to feature; MODIFIER | silent_mutation | Average:49.279; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0407825796 | C -> G | LOC_Os04g14000-LOC_Os04g14010 | intergenic_region ; MODIFIER | silent_mutation | Average:49.279; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407825796 | NA | 7.62E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0407825796 | NA | 2.48E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 4.52E-07 | 1.30E-11 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 3.69E-08 | 5.27E-12 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 2.64E-07 | 1.07E-11 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 1.87E-08 | 1.12E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 2.87E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.28E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.37E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 2.42E-16 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 8.22E-11 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 1.64E-07 | 3.50E-11 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 5.16E-07 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 6.74E-10 | 2.64E-26 | mr1495 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 4.87E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.56E-15 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 3.40E-10 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 4.90E-07 | 3.88E-17 | mr1794 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 2.81E-06 | 9.48E-13 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 5.70E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 8.74E-06 | 9.80E-08 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.53E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 8.32E-07 | 1.51E-13 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 2.43E-06 | 1.70E-13 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 8.50E-06 | 1.10E-10 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 3.73E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 5.46E-09 | 9.57E-23 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.02E-09 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 8.72E-07 | 8.49E-14 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 4.26E-08 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 8.24E-07 | 1.96E-12 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 9.20E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 3.47E-06 | 9.90E-13 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 5.90E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 3.80E-06 | 2.38E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 3.16E-07 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | 1.12E-08 | 5.28E-25 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.15E-06 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.93E-18 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 4.97E-16 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 2.74E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.28E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825796 | NA | 1.16E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |