\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407825687:

Variant ID: vg0407825687 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7825687
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAAGGTGAAGTAAATTCACTAGAAATTCAACCTCTTTTGAGAACACAGATAGAGGAAATCTAGAAGGATAATGAGGAGGTCCGAGAAATTAAGGAGC[G/A]
TATGGCCGCGGGATTTGCCAAAGAATTTTCAATCAATGAGAACGGAATCCTGTGGTATAAAAAGAGGATTTATATGCCTGAACAGGGTGATTTGAGAAAG

Reverse complement sequence

CTTTCTCAAATCACCCTGTTCAGGCATATAAATCCTCTTTTTATACCACAGGATTCCGTTCTCATTGATTGAAAATTCTTTGGCAAATCCCGCGGCCATA[C/T]
GCTCCTTAATTTCTCGGACCTCCTCATTATCCTTCTAGATTTCCTCTATCTGTGTTCTCAAAAGAGGTTGAATTTCTAGTGAATTTACTTCACCTTGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 14.80% 0.61% 17.54% NA
All Indica  2759 50.40% 24.90% 0.94% 23.81% NA
All Japonica  1512 90.10% 0.40% 0.13% 9.33% NA
Aus  269 98.10% 1.10% 0.00% 0.74% NA
Indica I  595 93.40% 1.30% 0.00% 5.21% NA
Indica II  465 45.80% 22.40% 1.94% 29.89% NA
Indica III  913 21.90% 45.00% 0.44% 32.64% NA
Indica Intermediate  786 53.60% 20.70% 1.65% 24.05% NA
Temperate Japonica  767 97.10% 0.10% 0.00% 2.74% NA
Tropical Japonica  504 82.90% 0.60% 0.40% 16.07% NA
Japonica Intermediate  241 83.00% 0.80% 0.00% 16.18% NA
VI/Aromatic  96 86.50% 1.00% 0.00% 12.50% NA
Intermediate  90 75.60% 4.40% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407825687 G -> DEL N N silent_mutation Average:45.891; most accessible tissue: Callus, score: 73.645 N N N N
vg0407825687 G -> A LOC_Os04g14010.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:45.891; most accessible tissue: Callus, score: 73.645 N N N N
vg0407825687 G -> A LOC_Os04g14000.1 downstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:45.891; most accessible tissue: Callus, score: 73.645 N N N N
vg0407825687 G -> A LOC_Os04g14020.1 downstream_gene_variant ; 2199.0bp to feature; MODIFIER silent_mutation Average:45.891; most accessible tissue: Callus, score: 73.645 N N N N
vg0407825687 G -> A LOC_Os04g14000-LOC_Os04g14010 intergenic_region ; MODIFIER silent_mutation Average:45.891; most accessible tissue: Callus, score: 73.645 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407825687 NA 2.78E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0407825687 NA 5.81E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 5.04E-07 6.92E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 1.07E-08 5.02E-12 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 3.37E-09 2.17E-13 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 5.00E-07 1.32E-19 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 6.86E-06 4.20E-10 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 9.97E-08 7.23E-10 mr1120 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 5.29E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 5.12E-17 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 4.53E-11 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 3.04E-08 1.93E-12 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 3.09E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 5.34E-08 4.36E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 3.70E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 1.15E-16 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 9.90E-11 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 2.49E-06 8.99E-18 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 6.95E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 8.86E-08 8.32E-10 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 7.94E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 6.45E-07 7.46E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 4.72E-07 2.42E-14 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 1.76E-06 3.04E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 8.84E-07 6.29E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 2.38E-10 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 1.25E-06 1.59E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 2.22E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 9.66E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 7.41E-06 2.38E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 1.42E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 2.46E-07 1.06E-09 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 4.65E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 7.67E-07 8.52E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 3.61E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 1.70E-19 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 1.31E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 1.09E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 3.23E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825687 NA 8.56E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251