\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407825281:

Variant ID: vg0407825281 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7825281
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGCAAGGCTTATGAGGAGTATTAATGCAAGAGGAAAAGGTTGTGGCCTATGCCTCACGGCAATTGCGACCCCATGAGGAGAATTACCCTACTCATGAC[C/A,T]
TGGAATTGGCGGCTGTAGTTCATGCATTAAAGATATGGAGGCATTATTTGATTGGGAATCATTGCGACATATACACGGATCACAAAAGCCTGAAATACAT

Reverse complement sequence

ATGTATTTCAGGCTTTTGTGATCCGTGTATATGTCGCAATGATTCCCAATCAAATAATGCCTCCATATCTTTAATGCATGAACTACAGCCGCCAATTCCA[G/T,A]
GTCATGAGTAGGGTAATTCTCCTCATGGGGTCGCAATTGCCGTGAGGCATAGGCCACAACCTTTTCCTCTTGCATTAATACTCCTCATAAGCCTTGCCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 1.00% 2.60% 12.53% T: 0.04%
All Indica  2759 73.20% 1.80% 4.31% 20.62% T: 0.07%
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 78.80% 5.70% 11.26% 4.20% NA
Indica II  465 71.60% 0.40% 2.80% 25.16% NA
Indica III  913 69.90% 0.00% 1.42% 28.48% T: 0.22%
Indica Intermediate  786 73.80% 1.70% 3.31% 21.25% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 2.08% 8.33% NA
Intermediate  90 85.60% 0.00% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407825281 C -> DEL N N silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> A LOC_Os04g14010.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> A LOC_Os04g14000.1 downstream_gene_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> A LOC_Os04g14020.1 downstream_gene_variant ; 2605.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> A LOC_Os04g14000-LOC_Os04g14010 intergenic_region ; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> T LOC_Os04g14010.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> T LOC_Os04g14000.1 downstream_gene_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> T LOC_Os04g14020.1 downstream_gene_variant ; 2605.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N
vg0407825281 C -> T LOC_Os04g14000-LOC_Os04g14010 intergenic_region ; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407825281 7.81E-06 1.45E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 NA 2.47E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 2.41E-07 1.83E-10 mr1070 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 2.62E-09 2.01E-11 mr1128 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 7.21E-06 2.52E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 NA 3.72E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 NA 2.71E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 1.56E-06 6.53E-11 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 NA 8.10E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407825281 NA 1.34E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251