\
| Variant ID: vg0407825281 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7825281 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGGCAAGGCTTATGAGGAGTATTAATGCAAGAGGAAAAGGTTGTGGCCTATGCCTCACGGCAATTGCGACCCCATGAGGAGAATTACCCTACTCATGAC[C/A,T]
TGGAATTGGCGGCTGTAGTTCATGCATTAAAGATATGGAGGCATTATTTGATTGGGAATCATTGCGACATATACACGGATCACAAAAGCCTGAAATACAT
ATGTATTTCAGGCTTTTGTGATCCGTGTATATGTCGCAATGATTCCCAATCAAATAATGCCTCCATATCTTTAATGCATGAACTACAGCCGCCAATTCCA[G/T,A]
GTCATGAGTAGGGTAATTCTCCTCATGGGGTCGCAATTGCCGTGAGGCATAGGCCACAACCTTTTCCTCTTGCATTAATACTCCTCATAAGCCTTGCCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.80% | 1.00% | 2.60% | 12.53% | T: 0.04% |
| All Indica | 2759 | 73.20% | 1.80% | 4.31% | 20.62% | T: 0.07% |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 78.80% | 5.70% | 11.26% | 4.20% | NA |
| Indica II | 465 | 71.60% | 0.40% | 2.80% | 25.16% | NA |
| Indica III | 913 | 69.90% | 0.00% | 1.42% | 28.48% | T: 0.22% |
| Indica Intermediate | 786 | 73.80% | 1.70% | 3.31% | 21.25% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 85.60% | 0.00% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407825281 | C -> DEL | N | N | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> A | LOC_Os04g14010.1 | upstream_gene_variant ; 732.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> A | LOC_Os04g14000.1 | downstream_gene_variant ; 85.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> A | LOC_Os04g14020.1 | downstream_gene_variant ; 2605.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> A | LOC_Os04g14000-LOC_Os04g14010 | intergenic_region ; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> T | LOC_Os04g14010.1 | upstream_gene_variant ; 732.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> T | LOC_Os04g14000.1 | downstream_gene_variant ; 85.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> T | LOC_Os04g14020.1 | downstream_gene_variant ; 2605.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| vg0407825281 | C -> T | LOC_Os04g14000-LOC_Os04g14010 | intergenic_region ; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.737 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407825281 | 7.81E-06 | 1.45E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | NA | 2.47E-08 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | 2.41E-07 | 1.83E-10 | mr1070 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | 2.62E-09 | 2.01E-11 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | 7.21E-06 | 2.52E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | NA | 3.72E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | NA | 2.71E-08 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | 1.56E-06 | 6.53E-11 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | NA | 8.10E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407825281 | NA | 1.34E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |