\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407824993:

Variant ID: vg0407824993 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7824993
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGCAGTGGATCCTGCTAAAGTGGAGGCTATGACGGAATGGAAGGCACCCAAATCGGTGACGAAAATCCGGAGCTTTTTGGGATTGGCCGAATATTAC[C/T]
GTAGGTTTATTGAGGGGTTTTCTAAAATAGCTAGGCCCATGACACAACTGTTAAAGAAAGAAAAGAAATTTGAGTGGATAGAACAATGCCAGGCAAGCTT

Reverse complement sequence

AAGCTTGCCTGGCATTGTTCTATCCACTCAAATTTCTTTTCTTTCTTTAACAGTTGTGTCATGGGCCTAGCTATTTTAGAAAACCCCTCAATAAACCTAC[G/A]
GTAATATTCGGCCAATCCCAAAAAGCTCCGGATTTTCGTCACCGATTTGGGTGCCTTCCATTCCGTCATAGCCTCCACTTTAGCAGGATCCACTGCTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 3.50% 1.48% 15.76% NA
All Indica  2759 82.90% 0.80% 1.70% 14.61% NA
All Japonica  1512 68.70% 8.60% 1.26% 21.49% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 97.50% 0.00% 0.17% 2.35% NA
Indica II  465 75.30% 1.30% 3.23% 20.22% NA
Indica III  913 77.30% 0.80% 1.42% 20.48% NA
Indica Intermediate  786 83.00% 1.00% 2.29% 13.74% NA
Temperate Japonica  767 96.70% 2.50% 0.13% 0.65% NA
Tropical Japonica  504 22.40% 17.50% 3.17% 56.94% NA
Japonica Intermediate  241 75.90% 9.50% 0.83% 13.69% NA
VI/Aromatic  96 92.70% 5.20% 1.04% 1.04% NA
Intermediate  90 70.00% 11.10% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407824993 C -> DEL LOC_Os04g14000.1 N frameshift_variant Average:64.007; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0407824993 C -> T LOC_Os04g14000.1 missense_variant ; p.Arg560Cys; MODERATE nonsynonymous_codon ; R560C Average:64.007; most accessible tissue: Zhenshan97 panicle, score: 89.143 probably damaging 3.512 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407824993 C T 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407824993 8.51E-06 8.51E-06 mr1313 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824993 1.22E-07 1.22E-07 mr1664 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251