\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407824609:

Variant ID: vg0407824609 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7824609
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGAAGGGGGCTAAGGTGTTCTCAAAAATTGATCTTCGGTCTGAGTATCATCAACTGAAGATTAGGCCCAGAGATATTCCTAAGACTGCATTCTCCACA[C/T]
GTTATGGATTATATGAGTTTACAGTGATGTCCTTTGGATTGACCAACGCCCCAGCTTACTTTATGAACCTTATGAACAAAGTGTTCATGGAATATTTGGA

Reverse complement sequence

TCCAAATATTCCATGAACACTTTGTTCATAAGGTTCATAAAGTAAGCTGGGGCGTTGGTCAATCCAAAGGACATCACTGTAAACTCATATAATCCATAAC[G/A]
TGTGGAGAATGCAGTCTTAGGAATATCTCTGGGCCTAATCTTCAGTTGATGATACTCAGACCGAAGATCAATTTTTGAGAACACCTTAGCCCCCTTCAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 17.60% 1.21% 12.36% NA
All Indica  2759 47.40% 29.90% 2.03% 20.62% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.13% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 15.10% 71.80% 2.35% 10.76% NA
Indica II  465 57.20% 16.80% 1.72% 24.30% NA
Indica III  913 59.90% 12.30% 2.08% 25.74% NA
Indica Intermediate  786 51.50% 26.60% 1.91% 19.97% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 81.10% 6.70% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407824609 C -> DEL LOC_Os04g14000.1 N frameshift_variant Average:50.816; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0407824609 C -> T LOC_Os04g14000.1 missense_variant ; p.Arg432Cys; MODERATE nonsynonymous_codon ; R432C Average:50.816; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 benign 1.11 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407824609 1.92E-08 2.19E-46 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 3.21E-07 1.51E-23 mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 3.85E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 7.67E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 3.38E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 4.63E-08 1.69E-21 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 9.14E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 7.32E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 3.30E-08 1.10E-43 mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 8.63E-07 4.34E-22 mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.97E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 1.56E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 1.39E-06 1.18E-24 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 5.44E-08 1.62E-25 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.26E-09 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.16E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 3.44E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.88E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.86E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 9.69E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.49E-22 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 1.39E-06 9.78E-28 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 1.68E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.96E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 8.74E-09 1.23E-45 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 1.41E-06 1.08E-23 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 6.24E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 6.63E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 8.59E-06 1.19E-31 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 8.34E-07 5.10E-29 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 1.36E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.21E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 7.11E-09 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.18E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 2.55E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407824609 NA 1.21E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251