Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407823910:

Variant ID: vg0407823910 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7823910
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

CGCATTCATTTATATCTTTGAAAGCAAGTCGACAACACAATTTAACCCGAGTAAGGTTAAGGAAACCGATGTTAGTACACTCACCTAGGGGTGAGATAAC[C/G,T]
GTAGATACTGCTTGTATTGATACTGTCTTAGAGATACGGTGTTTCCCTCAAACCTCATGGTTTTGATACCTCAAACGCTTGATGTCATACTGGGCATGGA

Reverse complement sequence

TCCATGCCCAGTATGACATCAAGCGTTTGAGGTATCAAAACCATGAGGTTTGAGGGAAACACCGTATCTCTAAGACAGTATCAATACAAGCAGTATCTAC[G/C,A]
GTTATCTCACCCCTAGGTGAGTGTACTAACATCGGTTTCCTTAACCTTACTCGGGTTAAATTGTGTTGTCGACTTGCTTTCAAAGATATAAATGAATGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	16.50%	0.83%	17.27%	G: 0.11%
All Indica	2759	47.60%	27.60%	1.27%	23.38%	G: 0.18%
All Japonica	1512	89.90%	0.60%	0.20%	9.26%	NA
Aus	269	98.10%	1.10%	0.00%	0.74%	NA
Indica I	595	93.60%	1.30%	0.00%	5.04%	NA
Indica II	465	31.20%	36.60%	3.01%	28.82%	G: 0.43%
Indica III	913	22.00%	45.20%	0.66%	31.98%	G: 0.11%
Indica Intermediate	786	52.20%	21.60%	1.91%	24.05%	G: 0.25%
Temperate Japonica	767	97.10%	0.10%	0.00%	2.74%	NA
Tropical Japonica	504	82.30%	1.20%	0.40%	16.07%	NA
Japonica Intermediate	241	83.00%	0.80%	0.41%	15.77%	NA
VI/Aromatic	96	86.50%	1.00%	0.00%	12.50%	NA
Intermediate	90	71.10%	8.90%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407823910	C -> DEL	N	N	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> G	LOC_Os04g13990.1	upstream_gene_variant ; 4124.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> G	LOC_Os04g14010.1	upstream_gene_variant ; 2103.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> G	LOC_Os04g14020.1	downstream_gene_variant ; 3976.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> G	LOC_Os04g14000.1	intron_variant ; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> T	LOC_Os04g13990.1	upstream_gene_variant ; 4124.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> T	LOC_Os04g14010.1	upstream_gene_variant ; 2103.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> T	LOC_Os04g14020.1	downstream_gene_variant ; 3976.0bp to feature; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0407823910	C -> T	LOC_Os04g14000.1	intron_variant ; MODIFIER	silent_mutation	Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407823910	NA	8.20E-10	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0407823910	NA	8.14E-11	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	1.95E-07	3.02E-12	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	3.22E-07	2.33E-12	mr1114	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	1.30E-07	1.15E-12	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	2.03E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	1.58E-09	3.54E-20	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	2.16E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.45E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	3.45E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.57E-10	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	3.12E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.49E-18	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.65E-11	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	6.86E-08	1.32E-10	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	2.22E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	1.04E-08	3.59E-25	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	3.51E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	2.58E-18	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	3.93E-11	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	2.25E-06	1.44E-18	mr1794	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	7.25E-07	4.62E-14	mr1794	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	4.35E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	9.85E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	4.72E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	4.38E-07	1.20E-13	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	3.14E-07	1.56E-14	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.40E-09	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	8.42E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	2.19E-08	4.94E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	7.78E-09	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	4.91E-07	4.20E-13	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	4.16E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	4.56E-07	NA	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	4.78E-06	1.62E-10	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	1.41E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	5.69E-06	3.99E-11	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	6.78E-06	1.04E-07	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	3.72E-09	NA	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	1.34E-10	1.28E-27	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	4.52E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	6.80E-22	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	3.57E-17	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	2.60E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823910	NA	4.03E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251