| Variant ID: vg0407823910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7823910 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )
CGCATTCATTTATATCTTTGAAAGCAAGTCGACAACACAATTTAACCCGAGTAAGGTTAAGGAAACCGATGTTAGTACACTCACCTAGGGGTGAGATAAC[C/G,T]
GTAGATACTGCTTGTATTGATACTGTCTTAGAGATACGGTGTTTCCCTCAAACCTCATGGTTTTGATACCTCAAACGCTTGATGTCATACTGGGCATGGA
TCCATGCCCAGTATGACATCAAGCGTTTGAGGTATCAAAACCATGAGGTTTGAGGGAAACACCGTATCTCTAAGACAGTATCAATACAAGCAGTATCTAC[G/C,A]
GTTATCTCACCCCTAGGTGAGTGTACTAACATCGGTTTCCTTAACCTTACTCGGGTTAAATTGTGTTGTCGACTTGCTTTCAAAGATATAAATGAATGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 16.50% | 0.83% | 17.27% | G: 0.11% |
| All Indica | 2759 | 47.60% | 27.60% | 1.27% | 23.38% | G: 0.18% |
| All Japonica | 1512 | 89.90% | 0.60% | 0.20% | 9.26% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.00% | 0.74% | NA |
| Indica I | 595 | 93.60% | 1.30% | 0.00% | 5.04% | NA |
| Indica II | 465 | 31.20% | 36.60% | 3.01% | 28.82% | G: 0.43% |
| Indica III | 913 | 22.00% | 45.20% | 0.66% | 31.98% | G: 0.11% |
| Indica Intermediate | 786 | 52.20% | 21.60% | 1.91% | 24.05% | G: 0.25% |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 82.30% | 1.20% | 0.40% | 16.07% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.80% | 0.41% | 15.77% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 71.10% | 8.90% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407823910 | C -> DEL | N | N | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> G | LOC_Os04g13990.1 | upstream_gene_variant ; 4124.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> G | LOC_Os04g14010.1 | upstream_gene_variant ; 2103.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> G | LOC_Os04g14020.1 | downstream_gene_variant ; 3976.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> G | LOC_Os04g14000.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> T | LOC_Os04g13990.1 | upstream_gene_variant ; 4124.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> T | LOC_Os04g14010.1 | upstream_gene_variant ; 2103.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> T | LOC_Os04g14020.1 | downstream_gene_variant ; 3976.0bp to feature; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0407823910 | C -> T | LOC_Os04g14000.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.455; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407823910 | NA | 8.20E-10 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0407823910 | NA | 8.14E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | 1.95E-07 | 3.02E-12 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | 3.22E-07 | 2.33E-12 | mr1114 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | 1.30E-07 | 1.15E-12 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | 2.03E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | 1.58E-09 | 3.54E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | NA | 2.16E-08 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | NA | 1.45E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823910 | NA | 3.45E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/