\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407823811:

Variant ID: vg0407823811 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7823811
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGCGAGCTGAGGAGGCCCAAGACGACCAGGGCGTACTGATGGGTATGTTTTCTATCAATACTACCCCAGTCAAAGTTCTCTTCGATTCGGGCGCATC[G/A]
CATTCATTTATATCTTTGAAAGCAAGTCGACAACACAATTTAACCCGAGTAAGGTTAAGGAAACCGATGTTAGTACACTCACCTAGGGGTGAGATAACCG

Reverse complement sequence

CGGTTATCTCACCCCTAGGTGAGTGTACTAACATCGGTTTCCTTAACCTTACTCGGGTTAAATTGTGTTGTCGACTTGCTTTCAAAGATATAAATGAATG[C/T]
GATGCGCCCGAATCGAAGAGAACTTTGACTGGGGTAGTATTGATAGAAAACATACCCATCAGTACGCCCTGGTCGTCTTGGGCCTCCTCAGCTCGCACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 20.60% 0.93% 9.92% NA
All Indica  2759 47.00% 34.90% 1.52% 16.49% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.13% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 13.90% 82.50% 1.01% 2.52% NA
Indica II  465 58.30% 17.40% 2.15% 22.15% NA
Indica III  913 59.60% 15.60% 1.42% 23.44% NA
Indica Intermediate  786 50.90% 31.80% 1.65% 15.65% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 81.10% 6.70% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407823811 G -> DEL N N silent_mutation Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0407823811 G -> A LOC_Os04g13990.1 upstream_gene_variant ; 4025.0bp to feature; MODIFIER silent_mutation Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0407823811 G -> A LOC_Os04g14010.1 upstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0407823811 G -> A LOC_Os04g14020.1 downstream_gene_variant ; 4075.0bp to feature; MODIFIER silent_mutation Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0407823811 G -> A LOC_Os04g14000.1 intron_variant ; MODIFIER silent_mutation Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407823811 6.01E-07 1.18E-45 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.49E-21 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 6.31E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.82E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 5.44E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 3.20E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 8.58E-08 2.30E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.50E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 1.25E-06 4.33E-43 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 3.20E-20 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 5.75E-06 4.58E-24 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 2.87E-07 7.44E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.38E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 8.45E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 3.25E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 7.50E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 2.71E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.92E-22 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 1.47E-06 1.38E-28 mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 2.68E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.13E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 1.56E-09 6.58E-48 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 7.31E-07 1.38E-24 mr1161_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 6.70E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 2.46E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 5.21E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 2.26E-31 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 5.14E-07 2.63E-29 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 2.23E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.70E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.20E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 9.66E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 5.94E-10 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407823811 NA 1.23E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251