| Variant ID: vg0407823811 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7823811 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 209. )
ATGTGCGAGCTGAGGAGGCCCAAGACGACCAGGGCGTACTGATGGGTATGTTTTCTATCAATACTACCCCAGTCAAAGTTCTCTTCGATTCGGGCGCATC[G/A]
CATTCATTTATATCTTTGAAAGCAAGTCGACAACACAATTTAACCCGAGTAAGGTTAAGGAAACCGATGTTAGTACACTCACCTAGGGGTGAGATAACCG
CGGTTATCTCACCCCTAGGTGAGTGTACTAACATCGGTTTCCTTAACCTTACTCGGGTTAAATTGTGTTGTCGACTTGCTTTCAAAGATATAAATGAATG[C/T]
GATGCGCCCGAATCGAAGAGAACTTTGACTGGGGTAGTATTGATAGAAAACATACCCATCAGTACGCCCTGGTCGTCTTGGGCCTCCTCAGCTCGCACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 20.60% | 0.93% | 9.92% | NA |
| All Indica | 2759 | 47.00% | 34.90% | 1.52% | 16.49% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 13.90% | 82.50% | 1.01% | 2.52% | NA |
| Indica II | 465 | 58.30% | 17.40% | 2.15% | 22.15% | NA |
| Indica III | 913 | 59.60% | 15.60% | 1.42% | 23.44% | NA |
| Indica Intermediate | 786 | 50.90% | 31.80% | 1.65% | 15.65% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 81.10% | 6.70% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407823811 | G -> DEL | N | N | silent_mutation | Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 | N | N | N | N |
| vg0407823811 | G -> A | LOC_Os04g13990.1 | upstream_gene_variant ; 4025.0bp to feature; MODIFIER | silent_mutation | Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 | N | N | N | N |
| vg0407823811 | G -> A | LOC_Os04g14010.1 | upstream_gene_variant ; 2202.0bp to feature; MODIFIER | silent_mutation | Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 | N | N | N | N |
| vg0407823811 | G -> A | LOC_Os04g14020.1 | downstream_gene_variant ; 4075.0bp to feature; MODIFIER | silent_mutation | Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 | N | N | N | N |
| vg0407823811 | G -> A | LOC_Os04g14000.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.562; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407823811 | 6.01E-07 | 1.18E-45 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 1.49E-21 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 6.31E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 1.82E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 5.44E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 3.20E-18 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | 8.58E-08 | 2.30E-21 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 1.50E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | 1.25E-06 | 4.33E-43 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407823811 | NA | 3.20E-20 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/