\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407822256:

Variant ID: vg0407822256 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7822256
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTCTAAAAATTCCATTTAAACAACAATTTATAAATTTTAAATTTTCAGGGTGTGACAGGGACTGAGGTTTGCGTCCGCCAGGGATTACCCGCTCC[C/G]
TGCACCAGGCACCTGTGGTTGGCTGGACGACTAGGCGGAAGGCCTACTGTGACTTCGATCTCGCTTTGGTTGGCTTTTGGACAGCGAGACACCCCCCTCT

Reverse complement sequence

AGAGGGGGGTGTCTCGCTGTCCAAAAGCCAACCAAAGCGAGATCGAAGTCACAGTAGGCCTTCCGCCTAGTCGTCCAGCCAACCACAGGTGCCTGGTGCA[G/C]
GGAGCGGGTAATCCCTGGCGGACGCAAACCTCAGTCCCTGTCACACCCTGAAAATTTAAAATTTATAAATTGTTGTTTAAATGGAATTTTTAGAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 13.60% 1.61% 13.06% NA
All Indica  2759 57.40% 22.70% 1.05% 18.81% NA
All Japonica  1512 91.00% 0.50% 2.84% 5.62% NA
Aus  269 98.10% 1.10% 0.00% 0.74% NA
Indica I  595 96.30% 1.20% 0.34% 2.18% NA
Indica II  465 50.10% 22.20% 2.15% 25.59% NA
Indica III  913 30.90% 41.30% 0.88% 26.94% NA
Indica Intermediate  786 63.10% 17.80% 1.15% 17.94% NA
Temperate Japonica  767 97.40% 0.10% 2.09% 0.39% NA
Tropical Japonica  504 84.10% 0.80% 2.58% 12.50% NA
Japonica Intermediate  241 85.10% 1.20% 5.81% 7.88% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 81.10% 3.30% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407822256 C -> DEL N N silent_mutation Average:65.592; most accessible tissue: Zhenshan97 flag leaf, score: 87.567 N N N N
vg0407822256 C -> G LOC_Os04g13990.1 upstream_gene_variant ; 2470.0bp to feature; MODIFIER silent_mutation Average:65.592; most accessible tissue: Zhenshan97 flag leaf, score: 87.567 N N N N
vg0407822256 C -> G LOC_Os04g14000.1 upstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:65.592; most accessible tissue: Zhenshan97 flag leaf, score: 87.567 N N N N
vg0407822256 C -> G LOC_Os04g14010.1 upstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:65.592; most accessible tissue: Zhenshan97 flag leaf, score: 87.567 N N N N
vg0407822256 C -> G LOC_Os04g13990-LOC_Os04g14000 intergenic_region ; MODIFIER silent_mutation Average:65.592; most accessible tissue: Zhenshan97 flag leaf, score: 87.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407822256 NA 6.47E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0407822256 NA 7.13E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 2.03E-07 2.36E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 7.94E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 9.55E-07 1.36E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 1.51E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 7.26E-08 6.06E-18 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 5.29E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 2.17E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 1.19E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 5.59E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 8.41E-11 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 1.47E-07 2.82E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 4.04E-07 4.96E-22 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 2.35E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 3.11E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 6.42E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 5.48E-07 1.85E-16 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 9.37E-08 9.31E-14 mr1794 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 2.53E-08 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 1.75E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 1.61E-07 2.68E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 6.21E-07 6.07E-15 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 9.91E-07 1.94E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 5.28E-08 1.67E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 2.75E-06 4.89E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 4.18E-07 2.31E-13 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 5.81E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 3.46E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 1.99E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 8.75E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 6.86E-07 1.24E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 1.97E-08 7.40E-12 mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 6.79E-06 1.21E-07 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 4.53E-08 9.07E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 2.85E-06 1.26E-22 mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 2.48E-06 3.52E-18 mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 9.02E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407822256 NA 2.82E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251