\
| Variant ID: vg0407783729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7783729 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.17, others allele: 0.00, population size: 154. )
TGGCAGTTCAGAACTTCATCAGATAGGACTGTCAGAAATCCCCATCGCCAGTGAATTCGGTGACGTGTTTCCGGAAGAACTACCCGGTATGCCGCCCAAG[T/C]
GGGAGATCGAGTTCCGGATAGATCTTGCTCCAGGAACAACTCCTCTGTACAAACGGCCCTACCGTATGGCAGCAAATGAACTTGCCGAAGTCAAGAAGCA
TGCTTCTTGACTTCGGCAAGTTCATTTGCTGCCATACGGTAGGGCCGTTTGTACAGAGGAGTTGTTCCTGGAGCAAGATCTATCCGGAACTCGATCTCCC[A/G]
CTTGGGCGGCATACCGGGTAGTTCTTCCGGAAACACGTCACCGAATTCACTGGCGATGGGGATTTCTGACAGTCCTATCTGATGAAGTTCTGAACTGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.40% | 2.90% | 44.99% | 10.69% | NA |
| All Indica | 2759 | 27.10% | 3.20% | 66.15% | 3.52% | NA |
| All Japonica | 1512 | 73.80% | 1.30% | 4.56% | 20.37% | NA |
| Aus | 269 | 7.40% | 0.00% | 58.74% | 33.83% | NA |
| Indica I | 595 | 29.20% | 1.50% | 65.21% | 4.03% | NA |
| Indica II | 465 | 21.30% | 4.50% | 73.55% | 0.65% | NA |
| Indica III | 913 | 26.60% | 3.90% | 63.96% | 5.48% | NA |
| Indica Intermediate | 786 | 29.60% | 2.80% | 65.01% | 2.54% | NA |
| Temperate Japonica | 767 | 96.50% | 0.10% | 0.91% | 2.48% | NA |
| Tropical Japonica | 504 | 41.10% | 2.20% | 8.53% | 48.21% | NA |
| Japonica Intermediate | 241 | 70.10% | 2.90% | 7.88% | 19.09% | NA |
| VI/Aromatic | 96 | 27.10% | 28.10% | 41.67% | 3.12% | NA |
| Intermediate | 90 | 51.10% | 4.40% | 37.78% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407783729 | T -> C | LOC_Os04g13930.1 | missense_variant ; p.Trp747Arg; MODERATE | nonsynonymous_codon ; W747R | Average:14.505; most accessible tissue: Zhenshan97 root, score: 29.203 | probably damaging |
-3.32 |
TOLERATED | 1.00 |
| vg0407783729 | T -> DEL | LOC_Os04g13930.1 | N | frameshift_variant | Average:14.505; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407783729 | NA | 3.27E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 1.09E-12 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 1.28E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 2.05E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 6.11E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 1.02E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 9.52E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 4.64E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 2.55E-08 | mr1704 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 7.78E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 9.50E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 3.81E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 1.46E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407783729 | NA | 1.90E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |