\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407783729:

Variant ID: vg0407783729 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7783729
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.17, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCAGTTCAGAACTTCATCAGATAGGACTGTCAGAAATCCCCATCGCCAGTGAATTCGGTGACGTGTTTCCGGAAGAACTACCCGGTATGCCGCCCAAG[T/C]
GGGAGATCGAGTTCCGGATAGATCTTGCTCCAGGAACAACTCCTCTGTACAAACGGCCCTACCGTATGGCAGCAAATGAACTTGCCGAAGTCAAGAAGCA

Reverse complement sequence

TGCTTCTTGACTTCGGCAAGTTCATTTGCTGCCATACGGTAGGGCCGTTTGTACAGAGGAGTTGTTCCTGGAGCAAGATCTATCCGGAACTCGATCTCCC[A/G]
CTTGGGCGGCATACCGGGTAGTTCTTCCGGAAACACGTCACCGAATTCACTGGCGATGGGGATTTCTGACAGTCCTATCTGATGAAGTTCTGAACTGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 2.90% 44.99% 10.69% NA
All Indica  2759 27.10% 3.20% 66.15% 3.52% NA
All Japonica  1512 73.80% 1.30% 4.56% 20.37% NA
Aus  269 7.40% 0.00% 58.74% 33.83% NA
Indica I  595 29.20% 1.50% 65.21% 4.03% NA
Indica II  465 21.30% 4.50% 73.55% 0.65% NA
Indica III  913 26.60% 3.90% 63.96% 5.48% NA
Indica Intermediate  786 29.60% 2.80% 65.01% 2.54% NA
Temperate Japonica  767 96.50% 0.10% 0.91% 2.48% NA
Tropical Japonica  504 41.10% 2.20% 8.53% 48.21% NA
Japonica Intermediate  241 70.10% 2.90% 7.88% 19.09% NA
VI/Aromatic  96 27.10% 28.10% 41.67% 3.12% NA
Intermediate  90 51.10% 4.40% 37.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407783729 T -> C LOC_Os04g13930.1 missense_variant ; p.Trp747Arg; MODERATE nonsynonymous_codon ; W747R Average:14.505; most accessible tissue: Zhenshan97 root, score: 29.203 probably damaging -3.32 TOLERATED 1.00
vg0407783729 T -> DEL LOC_Os04g13930.1 N frameshift_variant Average:14.505; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407783729 NA 3.27E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 1.09E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 1.28E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 2.05E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 6.11E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 1.02E-12 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 9.52E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 4.64E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 2.55E-08 mr1704 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 7.78E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 9.50E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 3.81E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 1.46E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407783729 NA 1.90E-17 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251