| Variant ID: vg0407782510 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7782510 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGACACCGTGCAGTGCAACGATGAGGAGAAAGTCATCTTTGCCACCCACCAGCTGCAGGGGCCCGCATCTCTTTGGTGGGACCACTTCCAGGCTACACA[G/A]
CCCGAGGGGCAGCCTATTACCTGGGCCCGCTTCACCGCCGCTTTCCGGAGGACCCATGTGCCCGCCGGAGTCATGGCCCTTAAGAAAAGGGAATTCCGGG
CCCGGAATTCCCTTTTCTTAAGGGCCATGACTCCGGCGGGCACATGGGTCCTCCGGAAAGCGGCGGTGAAGCGGGCCCAGGTAATAGGCTGCCCCTCGGG[C/T]
TGTGTAGCCTGGAAGTGGTCCCACCAAAGAGATGCGGGCCCCTGCAGCTGGTGGGTGGCAAAGATGACTTTCTCCTCATCGTTGCACTGCACGGTGTCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 5.70% | 6.50% | 12.89% | NA |
| All Indica | 2759 | 71.80% | 9.60% | 8.66% | 9.93% | NA |
| All Japonica | 1512 | 79.70% | 0.10% | 1.59% | 18.65% | NA |
| Aus | 269 | 71.40% | 1.10% | 12.27% | 15.24% | NA |
| Indica I | 595 | 78.70% | 3.00% | 6.89% | 11.43% | NA |
| Indica II | 465 | 77.40% | 4.70% | 10.75% | 7.10% | NA |
| Indica III | 913 | 60.80% | 17.60% | 9.75% | 11.83% | NA |
| Indica Intermediate | 786 | 76.20% | 8.00% | 7.51% | 8.27% | NA |
| Temperate Japonica | 767 | 97.30% | 0.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 52.00% | 0.20% | 3.37% | 44.44% | NA |
| Japonica Intermediate | 241 | 81.70% | 0.00% | 2.49% | 15.77% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 78.90% | 2.20% | 7.78% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407782510 | G -> DEL | LOC_Os04g13930.1 | N | frameshift_variant | Average:8.008; most accessible tissue: Callus, score: 27.496 | N | N | N | N |
| vg0407782510 | G -> A | LOC_Os04g13930.1 | synonymous_variant ; p.Gln366Gln; LOW | synonymous_codon | Average:8.008; most accessible tissue: Callus, score: 27.496 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407782510 | 9.36E-06 | 5.91E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | NA | 5.21E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | 3.27E-07 | 7.88E-11 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | 1.66E-08 | 1.66E-08 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | NA | 1.99E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | NA | 8.41E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | NA | 3.06E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407782510 | NA | 3.29E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |