\
| Variant ID: vg0407717352 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7717352 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGATTCATATCTTCGGAGTCAACCTCATACAAGTCACCACTTCATGTCATGCGTCAACACTAGCTTGTCATTACTAGGATACCAGGTTTGTCATCATAAG[A/G]
ATATCATGCTTGTCATTCACTTCTAACTTGCCACCAACTGTCTCATATTAGCTTTCCCGGTCTCCGGGTAATAGCTACTTCTGCTATTTGATGCCAGGGT
ACCCTGGCATCAAATAGCAGAAGTAGCTATTACCCGGAGACCGGGAAAGCTAATATGAGACAGTTGGTGGCAAGTTAGAAGTGAATGACAAGCATGATAT[T/C]
CTTATGATGACAAACCTGGTATCCTAGTAATGACAAGCTAGTGTTGACGCATGACATGAAGTGGTGACTTGTATGAGGTTGACTCCGAAGATATGAATCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 6.30% | 11.83% | 18.83% | NA |
| All Indica | 2759 | 49.10% | 4.00% | 18.09% | 28.81% | NA |
| All Japonica | 1512 | 94.10% | 0.00% | 0.60% | 5.29% | NA |
| Aus | 269 | 22.70% | 66.90% | 10.41% | 0.00% | NA |
| Indica I | 595 | 54.60% | 2.20% | 13.45% | 29.75% | NA |
| Indica II | 465 | 46.90% | 2.80% | 21.72% | 28.60% | NA |
| Indica III | 913 | 44.50% | 5.10% | 20.92% | 29.46% | NA |
| Indica Intermediate | 786 | 51.70% | 4.70% | 16.16% | 27.48% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 91.50% | 0.00% | 0.99% | 7.54% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.00% | 1.24% | 11.20% | NA |
| VI/Aromatic | 96 | 71.90% | 8.30% | 16.67% | 3.12% | NA |
| Intermediate | 90 | 77.80% | 1.10% | 7.78% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407717352 | A -> DEL | N | N | silent_mutation | Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 | N | N | N | N |
| vg0407717352 | A -> G | LOC_Os04g13820.1 | upstream_gene_variant ; 2624.0bp to feature; MODIFIER | silent_mutation | Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 | N | N | N | N |
| vg0407717352 | A -> G | LOC_Os04g13840.1 | downstream_gene_variant ; 1525.0bp to feature; MODIFIER | silent_mutation | Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 | N | N | N | N |
| vg0407717352 | A -> G | LOC_Os04g13830.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407717352 | NA | 1.18E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407717352 | NA | 4.75E-08 | mr1414 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407717352 | NA | 6.54E-07 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407717352 | NA | 4.63E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407717352 | NA | 3.93E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407717352 | NA | 8.70E-06 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |