\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407717352:

Variant ID: vg0407717352 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7717352
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTCATATCTTCGGAGTCAACCTCATACAAGTCACCACTTCATGTCATGCGTCAACACTAGCTTGTCATTACTAGGATACCAGGTTTGTCATCATAAG[A/G]
ATATCATGCTTGTCATTCACTTCTAACTTGCCACCAACTGTCTCATATTAGCTTTCCCGGTCTCCGGGTAATAGCTACTTCTGCTATTTGATGCCAGGGT

Reverse complement sequence

ACCCTGGCATCAAATAGCAGAAGTAGCTATTACCCGGAGACCGGGAAAGCTAATATGAGACAGTTGGTGGCAAGTTAGAAGTGAATGACAAGCATGATAT[T/C]
CTTATGATGACAAACCTGGTATCCTAGTAATGACAAGCTAGTGTTGACGCATGACATGAAGTGGTGACTTGTATGAGGTTGACTCCGAAGATATGAATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 6.30% 11.83% 18.83% NA
All Indica  2759 49.10% 4.00% 18.09% 28.81% NA
All Japonica  1512 94.10% 0.00% 0.60% 5.29% NA
Aus  269 22.70% 66.90% 10.41% 0.00% NA
Indica I  595 54.60% 2.20% 13.45% 29.75% NA
Indica II  465 46.90% 2.80% 21.72% 28.60% NA
Indica III  913 44.50% 5.10% 20.92% 29.46% NA
Indica Intermediate  786 51.70% 4.70% 16.16% 27.48% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 91.50% 0.00% 0.99% 7.54% NA
Japonica Intermediate  241 87.60% 0.00% 1.24% 11.20% NA
VI/Aromatic  96 71.90% 8.30% 16.67% 3.12% NA
Intermediate  90 77.80% 1.10% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407717352 A -> DEL N N silent_mutation Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 N N N N
vg0407717352 A -> G LOC_Os04g13820.1 upstream_gene_variant ; 2624.0bp to feature; MODIFIER silent_mutation Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 N N N N
vg0407717352 A -> G LOC_Os04g13840.1 downstream_gene_variant ; 1525.0bp to feature; MODIFIER silent_mutation Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 N N N N
vg0407717352 A -> G LOC_Os04g13830.1 intron_variant ; MODIFIER silent_mutation Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407717352 NA 1.18E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352 NA 4.75E-08 mr1414 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352 NA 6.54E-07 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352 NA 4.63E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352 NA 3.93E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352 NA 8.70E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251