Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407630134:

Variant ID: vg0407630134 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7630134
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTATGAGCACATTAGCCGATTCCTTGCTCAGTGTGGTGAAGCATCGGCTGTGGACGCCCTGAGAGTTAGGATGTTTCGATTATCTTTGTCCGGGTCAGC[G/T,A]
TTTACTTGGTTTTCATCTTTGCCATATGGGTCGGTCAATAGTTGGGCTGATTTAGAGAAGCAATTCCACAGCTATTTCTATAGCGGGGTCCACGAGATGA

Reverse complement sequence

TCATCTCGTGGACCCCGCTATAGAAATAGCTGTGGAATTGCTTCTCTAAATCAGCCCAACTATTGACCGACCCATATGGCAAAGATGAAAACCAAGTAAA[C/A,T]
GCTGACCCGGACAAAGATAATCGAAACATCCTAACTCTCAGGGCGTCCACAGCCGATGCTTCACCACACTGAGCAAGGAATCGGCTAATGTGCTCATAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.40%	0.20%	13.73%	50.66%	A: 0.02%
All Indica	2759	3.20%	0.30%	23.09%	73.47%	NA
All Japonica	1512	98.40%	0.00%	0.13%	1.39%	A: 0.07%
Aus	269	0.40%	0.00%	2.23%	97.40%	NA
Indica I	595	3.00%	0.00%	6.39%	90.59%	NA
Indica II	465	4.50%	0.00%	31.61%	63.87%	NA
Indica III	913	1.00%	0.10%	28.04%	70.87%	NA
Indica Intermediate	786	5.00%	0.90%	24.94%	69.21%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	97.00%	0.00%	0.20%	2.58%	A: 0.20%
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	52.10%	0.00%	0.00%	47.92%	NA
Intermediate	90	53.30%	0.00%	4.44%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407630134	G -> DEL	LOC_Os04g13670.1	N	frameshift_variant	Average:8.223; most accessible tissue: Callus, score: 35.752	N	N	N	N
vg0407630134	G -> A	LOC_Os04g13670.1	synonymous_variant ; p.Ala103Ala; LOW	synonymous_codon	Average:8.223; most accessible tissue: Callus, score: 35.752	N	N	N	N
vg0407630134	G -> T	LOC_Os04g13670.1	synonymous_variant ; p.Ala103Ala; LOW	synonymous_codon	Average:8.223; most accessible tissue: Callus, score: 35.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407630134	NA	3.54E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	3.50E-06	3.49E-06	mr1205	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	8.56E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	2.39E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	1.91E-06	3.78E-07	mr1298	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	2.44E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	1.51E-06	6.31E-06	mr1318	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	4.91E-07	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	2.83E-06	NA	mr1382	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	4.35E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	9.02E-09	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	4.27E-07	1.60E-07	mr1408	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	1.56E-06	NA	mr1460	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	9.32E-06	NA	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	4.32E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	5.51E-06	NA	mr1620	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	4.11E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	2.51E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	5.85E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	9.46E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	7.45E-08	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	4.04E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	NA	8.11E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	7.22E-06	9.33E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	5.89E-08	3.49E-06	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134	2.54E-08	2.38E-08	mr1974	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251