\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407630134:

Variant ID: vg0407630134 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7630134
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTATGAGCACATTAGCCGATTCCTTGCTCAGTGTGGTGAAGCATCGGCTGTGGACGCCCTGAGAGTTAGGATGTTTCGATTATCTTTGTCCGGGTCAGC[G/T,A]
TTTACTTGGTTTTCATCTTTGCCATATGGGTCGGTCAATAGTTGGGCTGATTTAGAGAAGCAATTCCACAGCTATTTCTATAGCGGGGTCCACGAGATGA

Reverse complement sequence

TCATCTCGTGGACCCCGCTATAGAAATAGCTGTGGAATTGCTTCTCTAAATCAGCCCAACTATTGACCGACCCATATGGCAAAGATGAAAACCAAGTAAA[C/A,T]
GCTGACCCGGACAAAGATAATCGAAACATCCTAACTCTCAGGGCGTCCACAGCCGATGCTTCACCACACTGAGCAAGGAATCGGCTAATGTGCTCATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 0.20% 13.73% 50.66% A: 0.02%
All Indica  2759 3.20% 0.30% 23.09% 73.47% NA
All Japonica  1512 98.40% 0.00% 0.13% 1.39% A: 0.07%
Aus  269 0.40% 0.00% 2.23% 97.40% NA
Indica I  595 3.00% 0.00% 6.39% 90.59% NA
Indica II  465 4.50% 0.00% 31.61% 63.87% NA
Indica III  913 1.00% 0.10% 28.04% 70.87% NA
Indica Intermediate  786 5.00% 0.90% 24.94% 69.21% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 97.00% 0.00% 0.20% 2.58% A: 0.20%
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 52.10% 0.00% 0.00% 47.92% NA
Intermediate  90 53.30% 0.00% 4.44% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407630134 G -> DEL LOC_Os04g13670.1 N frameshift_variant Average:8.223; most accessible tissue: Callus, score: 35.752 N N N N
vg0407630134 G -> A LOC_Os04g13670.1 synonymous_variant ; p.Ala103Ala; LOW synonymous_codon Average:8.223; most accessible tissue: Callus, score: 35.752 N N N N
vg0407630134 G -> T LOC_Os04g13670.1 synonymous_variant ; p.Ala103Ala; LOW synonymous_codon Average:8.223; most accessible tissue: Callus, score: 35.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407630134 NA 3.54E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 3.50E-06 3.49E-06 mr1205 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 8.56E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 2.39E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 1.91E-06 3.78E-07 mr1298 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 2.44E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 1.51E-06 6.31E-06 mr1318 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 4.91E-07 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 2.83E-06 NA mr1382 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 4.35E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 9.02E-09 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 4.27E-07 1.60E-07 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 1.56E-06 NA mr1460 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 9.32E-06 NA mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 4.32E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 5.51E-06 NA mr1620 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 4.11E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 2.51E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 5.85E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 9.46E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 7.45E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 4.04E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 NA 8.11E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 7.22E-06 9.33E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 5.89E-08 3.49E-06 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407630134 2.54E-08 2.38E-08 mr1974 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251