\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407629615:

Variant ID: vg0407629615 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7629615
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTTCAGCCGATTCAGCACCCGGGGTCGGTCAATGCATCGGCTGGGTTTGCAGCACCTGGGGGGCAACCTGCGCAGCAATTTGTGAATCAAGTTATCCC[G/A]
GAGCATTTGGTTCATCATGCACAACCGGATGGCGCCTTGGTACCTTAGATGGTTCCTGAGCACTTGGTACGCAATATTCAGCCGAATCTGCATAACTACC

Reverse complement sequence

GGTAGTTATGCAGATTCGGCTGAATATTGCGTACCAAGTGCTCAGGAACCATCTAAGGTACCAAGGCGCCATCCGGTTGTGCATGATGAACCAAATGCTC[C/T]
GGGATAACTTGATTCACAAATTGCTGCGCAGGTTGCCCCCCAGGTGCTGCAAACCCAGCCGATGCATTGACCGACCCCGGGTGCTGAATCGGCTGAACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.60% 11.60% 6.26% 45.60% NA
All Indica  2759 4.80% 19.60% 9.97% 65.60% NA
All Japonica  1512 98.50% 0.10% 0.00% 1.32% NA
Aus  269 2.60% 0.00% 4.46% 92.94% NA
Indica I  595 4.40% 2.70% 4.87% 88.07% NA
Indica II  465 4.30% 32.00% 16.77% 46.88% NA
Indica III  913 3.20% 23.50% 9.42% 63.86% NA
Indica Intermediate  786 7.40% 20.50% 10.43% 61.70% NA
Temperate Japonica  767 99.50% 0.10% 0.00% 0.39% NA
Tropical Japonica  504 97.40% 0.20% 0.00% 2.38% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 53.10% 1.00% 5.21% 40.62% NA
Intermediate  90 52.20% 3.30% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407629615 G -> DEL N N silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0407629615 G -> A LOC_Os04g13670.1 upstream_gene_variant ; 211.0bp to feature; MODIFIER silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0407629615 G -> A LOC_Os04g13680.1 upstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0407629615 G -> A LOC_Os04g13650.1 downstream_gene_variant ; 2642.0bp to feature; MODIFIER silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0407629615 G -> A LOC_Os04g13660.1 downstream_gene_variant ; 483.0bp to feature; MODIFIER silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0407629615 G -> A LOC_Os04g13660-LOC_Os04g13670 intergenic_region ; MODIFIER silent_mutation Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407629615 NA 5.56E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 9.26E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 6.29E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 6.20E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 1.28E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 3.01E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 9.79E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 7.61E-06 1.83E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 7.45E-08 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 3.49E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 5.88E-06 4.21E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 4.34E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 5.99E-07 9.49E-08 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 6.37E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 1.91E-06 NA mr1460 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 7.76E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 1.69E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 6.35E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 1.14E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 4.55E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 8.08E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 8.29E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 4.24E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 8.22E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615 NA 1.29E-06 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251