Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407629615:

Variant ID: vg0407629615 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7629615
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTTCAGCCGATTCAGCACCCGGGGTCGGTCAATGCATCGGCTGGGTTTGCAGCACCTGGGGGGCAACCTGCGCAGCAATTTGTGAATCAAGTTATCCC[G/A]
GAGCATTTGGTTCATCATGCACAACCGGATGGCGCCTTGGTACCTTAGATGGTTCCTGAGCACTTGGTACGCAATATTCAGCCGAATCTGCATAACTACC

Reverse complement sequence

GGTAGTTATGCAGATTCGGCTGAATATTGCGTACCAAGTGCTCAGGAACCATCTAAGGTACCAAGGCGCCATCCGGTTGTGCATGATGAACCAAATGCTC[C/T]
GGGATAACTTGATTCACAAATTGCTGCGCAGGTTGCCCCCCAGGTGCTGCAAACCCAGCCGATGCATTGACCGACCCCGGGTGCTGAATCGGCTGAACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.60%	11.60%	6.26%	45.60%	NA
All Indica	2759	4.80%	19.60%	9.97%	65.60%	NA
All Japonica	1512	98.50%	0.10%	0.00%	1.32%	NA
Aus	269	2.60%	0.00%	4.46%	92.94%	NA
Indica I	595	4.40%	2.70%	4.87%	88.07%	NA
Indica II	465	4.30%	32.00%	16.77%	46.88%	NA
Indica III	913	3.20%	23.50%	9.42%	63.86%	NA
Indica Intermediate	786	7.40%	20.50%	10.43%	61.70%	NA
Temperate Japonica	767	99.50%	0.10%	0.00%	0.39%	NA
Tropical Japonica	504	97.40%	0.20%	0.00%	2.38%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	53.10%	1.00%	5.21%	40.62%	NA
Intermediate	90	52.20%	3.30%	4.44%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407629615	G -> DEL	N	N	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0407629615	G -> A	LOC_Os04g13670.1	upstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0407629615	G -> A	LOC_Os04g13680.1	upstream_gene_variant ; 3659.0bp to feature; MODIFIER	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0407629615	G -> A	LOC_Os04g13650.1	downstream_gene_variant ; 2642.0bp to feature; MODIFIER	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0407629615	G -> A	LOC_Os04g13660.1	downstream_gene_variant ; 483.0bp to feature; MODIFIER	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0407629615	G -> A	LOC_Os04g13660-LOC_Os04g13670	intergenic_region ; MODIFIER	silent_mutation	Average:20.254; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407629615	NA	5.56E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	9.26E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	6.29E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	6.20E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	1.28E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	3.01E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	9.79E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	7.61E-06	1.83E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	7.45E-08	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	3.49E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	5.88E-06	4.21E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	4.34E-09	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	5.99E-07	9.49E-08	mr1408	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	6.37E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	1.91E-06	NA	mr1460	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	7.76E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	1.69E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	6.35E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	1.14E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	4.55E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	8.08E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	8.29E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	4.24E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	8.22E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407629615	NA	1.29E-06	mr1878	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251