Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407628337:

Variant ID: vg0407628337 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7628337
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTCACATATCCGAAGGCGAGTTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAGGCCTCGTGT[A/T]
TTCTGTCAACACGCTTTTGGCACACCCGGTGGGACCTGATTAGAAGTCAGACGTCAGTTCTTCCTCATGGCCGAGAAACAGGCACCACTACCATCAAGCC

Reverse complement sequence

GGCTTGATGGTAGTGGTGCCTGTTTCTCGGCCATGAGGAAGAACTGACGTCTGACTTCTAATCAGGTCCCACCGGGTGTGCCAAAAGCGTGTTGACAGAA[T/A]
ACACGAGGCCTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAACTCGCCTTCGGATATGTGAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.40%	22.50%	17.52%	24.61%	NA
All Indica	2759	3.00%	31.80%	26.06%	39.18%	NA
All Japonica	1512	98.50%	0.70%	0.26%	0.60%	NA
Aus	269	1.90%	49.10%	32.71%	16.36%	NA
Indica I	595	2.50%	20.30%	18.66%	58.49%	NA
Indica II	465	4.90%	38.10%	25.81%	31.18%	NA
Indica III	913	1.50%	37.70%	27.71%	33.08%	NA
Indica Intermediate	786	3.90%	29.80%	29.90%	36.39%	NA
Temperate Japonica	767	99.50%	0.10%	0.00%	0.39%	NA
Tropical Japonica	504	97.20%	1.20%	0.60%	0.99%	NA
Japonica Intermediate	241	97.90%	1.20%	0.41%	0.41%	NA
VI/Aromatic	96	52.10%	33.30%	4.17%	10.42%	NA
Intermediate	90	51.10%	13.30%	14.44%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407628337	A -> DEL	N	N	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N
vg0407628337	A -> T	LOC_Os04g13660.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N
vg0407628337	A -> T	LOC_Os04g13670.1	upstream_gene_variant ; 1489.0bp to feature; MODIFIER	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N
vg0407628337	A -> T	LOC_Os04g13680.1	upstream_gene_variant ; 4937.0bp to feature; MODIFIER	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N
vg0407628337	A -> T	LOC_Os04g13650.1	downstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N
vg0407628337	A -> T	LOC_Os04g13650-LOC_Os04g13660	intergenic_region ; MODIFIER	silent_mutation	Average:10.881; most accessible tissue: Callus, score: 22.385	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407628337	NA	6.08E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	1.96E-06	1.52E-06	mr1283	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	7.05E-06	7.05E-06	mr1384	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	6.15E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	1.09E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	1.21E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	4.38E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	2.81E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407628337	NA	6.82E-13	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251