\
| Variant ID: vg0407576542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7576542 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, T: 0.34, others allele: 0.00, population size: 89. )
CAGATAGCGTCCGTTACAGATGACTACTAACCTCAATCGGGTACTAAGTTATGACCCGTCACAAATGAGTATAATCCACAAAAAATATTAATTTTGTTTT[A/T]
TGGCTAGCTTCAGGCCTTTGCTAGCCATACCCGCTGTAAAAATGACAGAAACACATGCATATACAATATCCCCAGCATCACCCATTCATATACATGCATT
AATGCATGTATATGAATGGGTGATGCTGGGGATATTGTATATGCATGTGTTTCTGTCATTTTTACAGCGGGTATGGCTAGCAAAGGCCTGAAGCTAGCCA[T/A]
AAAACAAAATTAATATTTTTTGTGGATTATACTCATTTGTGACGGGTCATAACTTAGTACCCGATTGAGGTTAGTAGTCATCTGTAACGGACGCTATCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.00% | 13.80% | 0.32% | 63.86% | NA |
| All Indica | 2759 | 1.80% | 2.00% | 0.43% | 95.69% | NA |
| All Japonica | 1512 | 63.30% | 35.20% | 0.00% | 1.52% | NA |
| Aus | 269 | 0.40% | 0.00% | 0.37% | 99.26% | NA |
| Indica I | 595 | 2.20% | 0.20% | 0.17% | 97.48% | NA |
| Indica II | 465 | 2.20% | 2.60% | 0.86% | 94.41% | NA |
| Indica III | 913 | 1.00% | 3.00% | 0.55% | 95.51% | NA |
| Indica Intermediate | 786 | 2.40% | 2.00% | 0.25% | 95.29% | NA |
| Temperate Japonica | 767 | 96.00% | 3.50% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 9.90% | 87.30% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 71.00% | 27.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 8.30% | 42.70% | 1.04% | 47.92% | NA |
| Intermediate | 90 | 25.60% | 26.70% | 1.11% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407576542 | A -> DEL | N | N | silent_mutation | Average:10.421; most accessible tissue: Callus, score: 54.711 | N | N | N | N |
| vg0407576542 | A -> T | LOC_Os04g13560.1 | downstream_gene_variant ; 741.0bp to feature; MODIFIER | silent_mutation | Average:10.421; most accessible tissue: Callus, score: 54.711 | N | N | N | N |
| vg0407576542 | A -> T | LOC_Os04g13550-LOC_Os04g13560 | intergenic_region ; MODIFIER | silent_mutation | Average:10.421; most accessible tissue: Callus, score: 54.711 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407576542 | 1.49E-08 | NA | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 3.21E-06 | NA | mr1080 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 7.19E-08 | NA | mr1140 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 1.55E-07 | NA | mr1203 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 7.57E-06 | 2.78E-23 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 3.12E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 5.61E-07 | NA | mr1618 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 9.94E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 8.28E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 6.08E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 1.72E-07 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 3.06E-09 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 3.79E-06 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 9.55E-10 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 1.00E-22 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 2.04E-18 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 5.41E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 8.01E-08 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | 1.20E-07 | NA | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 2.21E-11 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407576542 | NA | 1.57E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |