\
| Variant ID: vg0407565317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7565317 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 109. )
ATAGTTGCCATGTCCCTATAATCATGATTACCATTATTAATTTACAGAGGTAAATTAATAAAAAACATGATATTGCAGTTGTAATCTCAATGCGAAATGT[A/G]
AGACTTCATATTTTGTAATGTTTCGAAAAGATGTAGGTAATAGACCTGACAATTTGATTTAGAATTCGAATTTAGGTGGCACAAAAGTGGATAATCTCCA
TGGAGATTATCCACTTTTGTGCCACCTAAATTCGAATTCTAAATCAAATTGTCAGGTCTATTACCTACATCTTTTCGAAACATTACAAAATATGAAGTCT[T/C]
ACATTTCGCATTGAGATTACAACTGCAATATCATGTTTTTTATTAATTTACCTCTGTAAATTAATAATGGTAATCATGATTATAGGGACATGGCAACTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.60% | 12.30% | 3.39% | 53.70% | NA |
| All Indica | 2759 | 13.00% | 1.90% | 5.04% | 80.03% | NA |
| All Japonica | 1512 | 65.20% | 33.40% | 0.20% | 1.19% | NA |
| Aus | 269 | 5.60% | 0.40% | 3.72% | 90.33% | NA |
| Indica I | 595 | 11.60% | 0.30% | 8.07% | 80.00% | NA |
| Indica II | 465 | 26.00% | 2.60% | 4.09% | 67.31% | NA |
| Indica III | 913 | 9.40% | 2.70% | 3.61% | 84.23% | NA |
| Indica Intermediate | 786 | 10.70% | 1.70% | 4.96% | 82.70% | NA |
| Temperate Japonica | 767 | 96.20% | 3.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 14.90% | 82.30% | 0.60% | 2.18% | NA |
| Japonica Intermediate | 241 | 71.80% | 26.60% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 47.90% | 6.20% | 8.33% | 37.50% | NA |
| Intermediate | 90 | 44.40% | 18.90% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407565317 | A -> DEL | N | N | silent_mutation | Average:11.864; most accessible tissue: Callus, score: 29.229 | N | N | N | N |
| vg0407565317 | A -> G | LOC_Os04g13550.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Callus, score: 29.229 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407565317 | 2.54E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 3.66E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 9.24E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 2.90E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 3.35E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 5.77E-16 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 3.21E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 2.68E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 9.31E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 1.26E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 1.76E-28 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 6.12E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 9.47E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 7.45E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 1.72E-10 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 4.53E-11 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 8.49E-09 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 4.49E-13 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 1.52E-06 | 2.29E-25 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 1.24E-18 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 7.89E-17 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 4.90E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 4.43E-14 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 3.46E-11 | NA | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | 7.12E-07 | NA | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 6.09E-12 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407565317 | NA | 2.90E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |