\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407565317:

Variant ID: vg0407565317 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7565317
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTTGCCATGTCCCTATAATCATGATTACCATTATTAATTTACAGAGGTAAATTAATAAAAAACATGATATTGCAGTTGTAATCTCAATGCGAAATGT[A/G]
AGACTTCATATTTTGTAATGTTTCGAAAAGATGTAGGTAATAGACCTGACAATTTGATTTAGAATTCGAATTTAGGTGGCACAAAAGTGGATAATCTCCA

Reverse complement sequence

TGGAGATTATCCACTTTTGTGCCACCTAAATTCGAATTCTAAATCAAATTGTCAGGTCTATTACCTACATCTTTTCGAAACATTACAAAATATGAAGTCT[T/C]
ACATTTCGCATTGAGATTACAACTGCAATATCATGTTTTTTATTAATTTACCTCTGTAAATTAATAATGGTAATCATGATTATAGGGACATGGCAACTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.60% 12.30% 3.39% 53.70% NA
All Indica  2759 13.00% 1.90% 5.04% 80.03% NA
All Japonica  1512 65.20% 33.40% 0.20% 1.19% NA
Aus  269 5.60% 0.40% 3.72% 90.33% NA
Indica I  595 11.60% 0.30% 8.07% 80.00% NA
Indica II  465 26.00% 2.60% 4.09% 67.31% NA
Indica III  913 9.40% 2.70% 3.61% 84.23% NA
Indica Intermediate  786 10.70% 1.70% 4.96% 82.70% NA
Temperate Japonica  767 96.20% 3.40% 0.00% 0.39% NA
Tropical Japonica  504 14.90% 82.30% 0.60% 2.18% NA
Japonica Intermediate  241 71.80% 26.60% 0.00% 1.66% NA
VI/Aromatic  96 47.90% 6.20% 8.33% 37.50% NA
Intermediate  90 44.40% 18.90% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407565317 A -> DEL N N silent_mutation Average:11.864; most accessible tissue: Callus, score: 29.229 N N N N
vg0407565317 A -> G LOC_Os04g13550.1 intron_variant ; MODIFIER silent_mutation Average:11.864; most accessible tissue: Callus, score: 29.229 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407565317 2.54E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 3.66E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 9.24E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 2.90E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 3.35E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 5.77E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 3.21E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 2.68E-14 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 9.31E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 1.26E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 1.76E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 6.12E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 9.47E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 7.45E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 1.72E-10 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 4.53E-11 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 8.49E-09 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 4.49E-13 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 1.52E-06 2.29E-25 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 1.24E-18 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 7.89E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 4.90E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 4.43E-14 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 3.46E-11 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 7.12E-07 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 6.09E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565317 NA 2.90E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251