\
| Variant ID: vg0407554949 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7554949 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 109. )
ATGTAAGCAAAATCTATTATATACTAAAAGTCCATTGATCTTTCTAAAAACGCTCTCAAACCACCACATGGCCTCCTACACATGGCCTCCTACAAACGCT[C/T]
CTAAGTCGTCATGTGTCATTTTATAATCTCACTGTTGATTTTCTTTTAAATTGGTAGACCCATTAATTTTAATCGTTAGATCTCCATTAAAAAAATAAAT
ATTTATTTTTTTAATGGAGATCTAACGATTAAAATTAATGGGTCTACCAATTTAAAAGAAAATCAACAGTGAGATTATAAAATGACACATGACGACTTAG[G/A]
AGCGTTTGTAGGAGGCCATGTGTAGGAGGCCATGTGGTGGTTTGAGAGCGTTTTTAGAAAGATCAATGGACTTTTAGTATATAATAGATTTTGCTTACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 36.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 51.30% | 48.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.80% | 23.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 48.20% | 51.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 40.90% | 59.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 45.90% | 53.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407554949 | C -> T | LOC_Os04g13540.1 | upstream_gene_variant ; 244.0bp to feature; MODIFIER | silent_mutation | Average:53.907; most accessible tissue: Callus, score: 74.726 | N | N | N | N |
| vg0407554949 | C -> T | LOC_Os04g13530.1 | downstream_gene_variant ; 3315.0bp to feature; MODIFIER | silent_mutation | Average:53.907; most accessible tissue: Callus, score: 74.726 | N | N | N | N |
| vg0407554949 | C -> T | LOC_Os04g13540-LOC_Os04g13550 | intergenic_region ; MODIFIER | silent_mutation | Average:53.907; most accessible tissue: Callus, score: 74.726 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407554949 | NA | 1.17E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 7.55E-06 | mr1304 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 2.05E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 2.66E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 1.07E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 4.45E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 3.47E-07 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 8.58E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 3.13E-17 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 7.67E-10 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 9.63E-10 | 1.29E-25 | mr1846 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 1.13E-10 | 2.82E-18 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 1.24E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | NA | 6.55E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 2.30E-06 | 2.53E-19 | mr1830_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 3.75E-06 | 2.04E-15 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 1.19E-11 | 5.55E-46 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407554949 | 3.43E-12 | 1.87E-32 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |