| Variant ID: vg0407541897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7541897 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 236. )
GGTTTGTATATGCCTCTTCTTGTACCTTTTATTCCTTGGGCAAATATTTTTATGATGATGCGGACATCACTCCTTTGGATACACACAACAATCCTCCAAC[G/A]
GTTATTCAAGGACCGATAACAAGAGCTCGCGCGTGACAATTGAATTTAGAGGTGAGGAACAAGGTGAGCTCGTTCCTATGTTCTTGTTTGTATGAATTTG
CAAATTCATACAAACAAGAACATAGGAACGAGCTCACCTTGTTCCTCACCTCTAAATTCAATTGTCACGCGCGAGCTCTTGTTATCGGTCCTTGAATAAC[C/T]
GTTGGAGGATTGTTGTGTGTATCCAAAGGAGTGATGTCCGCATCATCATAAAAATATTTGCCCAAGGAATAAAAGGTACAAGAAGAGGCATATACAAACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.60% | 22.90% | 0.02% | 0.47% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 33.10% | 65.40% | 0.00% | 1.46% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 15.50% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 27.00% | 72.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407541897 | G -> DEL | N | N | silent_mutation | Average:32.35; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0407541897 | G -> A | LOC_Os04g13510.1 | upstream_gene_variant ; 4454.0bp to feature; MODIFIER | silent_mutation | Average:32.35; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0407541897 | G -> A | LOC_Os04g13520.1 | upstream_gene_variant ; 686.0bp to feature; MODIFIER | silent_mutation | Average:32.35; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0407541897 | G -> A | LOC_Os04g13530.1 | upstream_gene_variant ; 3380.0bp to feature; MODIFIER | silent_mutation | Average:32.35; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0407541897 | G -> A | LOC_Os04g13520-LOC_Os04g13530 | intergenic_region ; MODIFIER | silent_mutation | Average:32.35; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407541897 | NA | 1.92E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 2.10E-28 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 4.66E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 4.06E-41 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 3.72E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 1.41E-29 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 3.98E-10 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 2.08E-13 | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 2.57E-08 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407541897 | NA | 4.41E-45 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/