Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407491126:

Variant ID: vg0407491126 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7491126
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAACCCACAGATTTTGACAACCTATCTACCCCAACCAAGAATCTTAACATAGATACATGTATTGCAGCAAGACATCAGTACATGTTAAACCAGCAGTA[C/T]
GACAAATTACCATGAAACACGGGTGGAGAAGTGCTTTTTACTCTCGGTTCATGACCCCCCTGTAGTCCCGGTTTTTCAACCGGGACTACGAATCCGGGAC

Reverse complement sequence

GTCCCGGATTCGTAGTCCCGGTTGAAAAACCGGGACTACAGGGGGGTCATGAACCGAGAGTAAAAAGCACTTCTCCACCCGTGTTTCATGGTAATTTGTC[G/A]
TACTGCTGGTTTAACATGTACTGATGTCTTGCTGCAATACATGTATCTATGTTAAGATTCTTGGTTGGGGTAGATAGGTTGTCAAAATCTGTGGGTTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 25.10% 0.08% 0.00% NA
All Indica  2759 95.00% 4.90% 0.07% 0.00% NA
All Japonica  1512 35.00% 64.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.60% 10.30% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.70% 0.13% 0.00% NA
Temperate Japonica  767 3.80% 96.10% 0.13% 0.00% NA
Tropical Japonica  504 85.50% 14.50% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 71.00% 0.41% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407491126 C -> T LOC_Os04g13450.1 upstream_gene_variant ; 1731.0bp to feature; MODIFIER silent_mutation Average:65.591; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0407491126 C -> T LOC_Os04g13460.1 downstream_gene_variant ; 1345.0bp to feature; MODIFIER silent_mutation Average:65.591; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0407491126 C -> T LOC_Os04g13450-LOC_Os04g13460 intergenic_region ; MODIFIER silent_mutation Average:65.591; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407491126 NA 8.94E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 1.28E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 1.98E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 3.21E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 7.02E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 8.75E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 5.49E-06 3.13E-10 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 4.08E-09 4.19E-08 mr1946 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 1.70E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 1.09E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 5.50E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407491126 NA 7.68E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251