Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407382502:

Variant ID: vg0407382502 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7382502
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.04, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGTCGAGTGGTAACGATCTATGATCTAATACTTACATGGTTCCTGGTTTACGCGATAGAAATTTTTGATTTATGCTATCGTAGCCTACGCGTATCCCA[A/T]
CAGCAACCACAGGGACGGGGGTTCCATCCGGTGCACACCTCTTGGTTGTCCTCCTCTTCGACCACCGTAGGATGGATCTCTGCACCGAGCGTCTTGAGGT

Reverse complement sequence

ACCTCAAGACGCTCGGTGCAGAGATCCATCCTACGGTGGTCGAAGAGGAGGACAACCAAGAGGTGTGCACCGGATGGAACCCCCGTCCCTGTGGTTGCTG[T/A]
TGGGATACGCGTAGGCTACGATAGCATAAATCAAAAATTTCTATCGCGTAAACCAGGAACCATGTAAGTATTAGATCATAGATCGTTACCACTCGACGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 29.80% 0.06% 0.00% NA
All Indica  2759 56.20% 43.70% 0.11% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 77.00% 23.00% 0.00% 0.00% NA
Indica II  465 49.90% 50.10% 0.00% 0.00% NA
Indica III  913 50.80% 49.10% 0.11% 0.00% NA
Indica Intermediate  786 50.40% 49.40% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407382502 A -> T LOC_Os04g13290-LOC_Os04g13300 intergenic_region ; MODIFIER silent_mutation Average:89.723; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407382502 A T -0.08 -0.03 -0.03 -0.08 -0.06 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407382502 NA 1.21E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 7.33E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 8.51E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 6.19E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 3.89E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 2.82E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 7.07E-09 1.72E-19 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 4.81E-11 6.64E-19 mr1846 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 9.49E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 2.37E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 1.58E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 2.38E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 2.26E-15 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 NA 1.44E-13 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 2.23E-07 7.86E-29 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407382502 8.65E-11 4.54E-30 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251