\
| Variant ID: vg0407370896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7370896 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTTTGCAACCTCAAAAAAAGGCCAACAAAAATAGTATGACACTTTTCTGTTGGGCACCTTTTTATCTGCATCGTAGTAATTCCAAAGAATTATCTAACC[G/A]
CACAAAAAGCATTTTAATGGTATTGGGCTATTTTATTGTGAGCAATTTTGCCAAAGCAAAAAATATGCCTAAGTCCCTAAGGGTCACAACCAGCCACACC
GGTGTGGCTGGTTGTGACCCTTAGGGACTTAGGCATATTTTTTGCTTTGGCAAAATTGCTCACAATAAAATAGCCCAATACCATTAAAATGCTTTTTGTG[C/T]
GGTTAGATAATTCTTTGGAATTACTACGATGCAGATAAAAAGGTGCCCAACAGAAAAGTGTCATACTATTTTTGTTGGCCTTTTTTTGAGGTTGCAAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 1.50% | 1.33% | 0.66% | NA |
| All Indica | 2759 | 95.60% | 2.50% | 1.85% | 0.04% | NA |
| All Japonica | 1512 | 97.60% | 0.00% | 0.40% | 1.98% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 89.70% | 7.90% | 2.35% | 0.00% | NA |
| Indica II | 465 | 97.40% | 0.90% | 1.51% | 0.22% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 2.30% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 0.00% | 0.99% | 5.75% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407370896 | G -> DEL | N | N | silent_mutation | Average:48.225; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0407370896 | G -> A | LOC_Os04g13290.1 | upstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:48.225; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0407370896 | G -> A | LOC_Os04g13280-LOC_Os04g13290 | intergenic_region ; MODIFIER | silent_mutation | Average:48.225; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407370896 | NA | 1.60E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 1.29E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 7.81E-06 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 1.32E-07 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 6.98E-08 | mr1015_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 7.87E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407370896 | NA | 8.40E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |