Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407333553:

Variant ID: vg0407333553 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7333553
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GAATTAAACTCATGTTAGCTAAGCGCGTCATACAACCGAAATTCACATGACAAAGTCGCGAATGCCACACATTAGACTCATCATTCTTGCTAATATGGTT[A/C]
ACAACATTATGATTATTACACATGTCATTCAAAGAAAAGCGGAACAAGCCTCCGATGTCATAACCTTTTCCAACAAAAGTCCCATATTTAGATACGACAC

Reverse complement sequence

GTGTCGTATCTAAATATGGGACTTTTGTTGGAAAAGGTTATGACATCGGAGGCTTGTTCCGCTTTTCTTTGAATGACATGTGTAATAATCATAATGTTGT[T/G]
AACCATATTAGCAAGAATGATGAGTCTAATGTGTGGCATTCGCGACTTTGTCATGTGAATTTCGGTTGTATGACGCGCTTAGCTAACATGAGTTTAATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.90%	1.10%	45.66%	27.38%	NA
All Indica	2759	6.50%	1.60%	48.82%	43.06%	NA
All Japonica	1512	64.30%	0.20%	29.89%	5.62%	NA
Aus	269	0.00%	1.10%	94.80%	4.09%	NA
Indica I	595	1.50%	4.20%	27.73%	66.55%	NA
Indica II	465	2.80%	1.10%	70.32%	25.81%	NA
Indica III	913	14.30%	0.10%	49.18%	36.36%	NA
Indica Intermediate	786	3.40%	1.70%	51.65%	43.26%	NA
Temperate Japonica	767	96.50%	0.10%	2.87%	0.52%	NA
Tropical Japonica	504	14.70%	0.40%	70.63%	14.29%	NA
Japonica Intermediate	241	65.60%	0.00%	30.71%	3.73%	NA
VI/Aromatic	96	44.80%	0.00%	55.21%	0.00%	NA
Intermediate	90	32.20%	0.00%	56.67%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407333553	A -> C	LOC_Os04g13230.1	upstream_gene_variant ; 3756.0bp to feature; MODIFIER	silent_mutation	Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721	N	N	N	N
vg0407333553	A -> C	LOC_Os04g13240.1	intron_variant ; MODIFIER	silent_mutation	Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721	N	N	N	N
vg0407333553	A -> DEL	N	N	silent_mutation	Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407333553	NA	1.21E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	9.08E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.40E-11	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	2.78E-06	3.87E-30	mr1072	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	3.01E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	2.48E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.03E-12	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.20E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.21E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	3.29E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	4.58E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	8.11E-10	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	5.43E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.34E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	2.18E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	8.42E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	3.05E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.02E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	7.76E-18	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.30E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.71E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	9.39E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	2.16E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	5.55E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	4.36E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553	NA	1.94E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251