\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407333553:

Variant ID: vg0407333553 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7333553
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTAAACTCATGTTAGCTAAGCGCGTCATACAACCGAAATTCACATGACAAAGTCGCGAATGCCACACATTAGACTCATCATTCTTGCTAATATGGTT[A/C]
ACAACATTATGATTATTACACATGTCATTCAAAGAAAAGCGGAACAAGCCTCCGATGTCATAACCTTTTCCAACAAAAGTCCCATATTTAGATACGACAC

Reverse complement sequence

GTGTCGTATCTAAATATGGGACTTTTGTTGGAAAAGGTTATGACATCGGAGGCTTGTTCCGCTTTTCTTTGAATGACATGTGTAATAATCATAATGTTGT[T/G]
AACCATATTAGCAAGAATGATGAGTCTAATGTGTGGCATTCGCGACTTTGTCATGTGAATTTCGGTTGTATGACGCGCTTAGCTAACATGAGTTTAATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.90% 1.10% 45.66% 27.38% NA
All Indica  2759 6.50% 1.60% 48.82% 43.06% NA
All Japonica  1512 64.30% 0.20% 29.89% 5.62% NA
Aus  269 0.00% 1.10% 94.80% 4.09% NA
Indica I  595 1.50% 4.20% 27.73% 66.55% NA
Indica II  465 2.80% 1.10% 70.32% 25.81% NA
Indica III  913 14.30% 0.10% 49.18% 36.36% NA
Indica Intermediate  786 3.40% 1.70% 51.65% 43.26% NA
Temperate Japonica  767 96.50% 0.10% 2.87% 0.52% NA
Tropical Japonica  504 14.70% 0.40% 70.63% 14.29% NA
Japonica Intermediate  241 65.60% 0.00% 30.71% 3.73% NA
VI/Aromatic  96 44.80% 0.00% 55.21% 0.00% NA
Intermediate  90 32.20% 0.00% 56.67% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407333553 A -> C LOC_Os04g13230.1 upstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721 N N N N
vg0407333553 A -> C LOC_Os04g13240.1 intron_variant ; MODIFIER silent_mutation Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721 N N N N
vg0407333553 A -> DEL N N silent_mutation Average:18.241; most accessible tissue: Minghui63 flag leaf, score: 25.721 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407333553 NA 1.21E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 9.08E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.40E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 2.78E-06 3.87E-30 mr1072 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 3.01E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 2.48E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.03E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.20E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.21E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 3.29E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 4.58E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 8.11E-10 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 5.43E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.34E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 2.18E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 8.42E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 3.05E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.02E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 7.76E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.30E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.71E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 9.39E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 2.16E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 5.55E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 4.36E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407333553 NA 1.94E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251