\
| Variant ID: vg0407271283 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7271283 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 281. )
TAAACTTACATCAAAACAAAACCCAAAATGCAAAATGGTGGCTGCTAGGAGTTTATATAGGTGGAGGAATGACCAGGAGAGGAGGTGGGAGCAAACCCTA[G/A]
GTTTTGTGGACCCCTAATGGGCTGTAAAGATACAAGGCCCAAGCCTAAGTTTCTGATGTAAAGAACTATTTTCGTCATTCTGAGCAGCCTGGGTCAAATT
AATTTGACCCAGGCTGCTCAGAATGACGAAAATAGTTCTTTACATCAGAAACTTAGGCTTGGGCCTTGTATCTTTACAGCCCATTAGGGGTCCACAAAAC[C/T]
TAGGGTTTGCTCCCACCTCCTCTCCTGGTCATTCCTCCACCTATATAAACTCCTAGCAGCCACCATTTTGCATTTTGGGTTTTGTTTTGATGTAAGTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.20% | 23.10% | 4.78% | 1.90% | NA |
| All Indica | 2759 | 56.30% | 33.10% | 7.61% | 3.04% | NA |
| All Japonica | 1512 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 56.90% | 40.10% | 1.86% | 1.12% | NA |
| Indica I | 595 | 77.10% | 15.80% | 6.05% | 1.01% | NA |
| Indica II | 465 | 49.90% | 43.70% | 4.73% | 1.72% | NA |
| Indica III | 913 | 50.20% | 36.60% | 7.78% | 5.48% | NA |
| Indica Intermediate | 786 | 51.30% | 35.90% | 10.31% | 2.54% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 28.10% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 27.80% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407271283 | G -> DEL | N | N | silent_mutation | Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg0407271283 | G -> A | LOC_Os04g13170.1 | upstream_gene_variant ; 4011.0bp to feature; MODIFIER | silent_mutation | Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg0407271283 | G -> A | LOC_Os04g13180.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407271283 | NA | 2.55E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 5.19E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 2.54E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 5.34E-08 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 1.67E-14 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 7.74E-13 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 1.48E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | NA | 1.34E-15 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | 9.63E-07 | 2.55E-15 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | 4.55E-08 | 6.69E-30 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407271283 | 8.94E-12 | 1.34E-33 | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |