\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407271283:

Variant ID: vg0407271283 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7271283
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TAAACTTACATCAAAACAAAACCCAAAATGCAAAATGGTGGCTGCTAGGAGTTTATATAGGTGGAGGAATGACCAGGAGAGGAGGTGGGAGCAAACCCTA[G/A]
GTTTTGTGGACCCCTAATGGGCTGTAAAGATACAAGGCCCAAGCCTAAGTTTCTGATGTAAAGAACTATTTTCGTCATTCTGAGCAGCCTGGGTCAAATT

Reverse complement sequence

AATTTGACCCAGGCTGCTCAGAATGACGAAAATAGTTCTTTACATCAGAAACTTAGGCTTGGGCCTTGTATCTTTACAGCCCATTAGGGGTCCACAAAAC[C/T]
TAGGGTTTGCTCCCACCTCCTCTCCTGGTCATTCCTCCACCTATATAAACTCCTAGCAGCCACCATTTTGCATTTTGGGTTTTGTTTTGATGTAAGTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 23.10% 4.78% 1.90% NA
All Indica  2759 56.30% 33.10% 7.61% 3.04% NA
All Japonica  1512 98.70% 1.10% 0.13% 0.00% NA
Aus  269 56.90% 40.10% 1.86% 1.12% NA
Indica I  595 77.10% 15.80% 6.05% 1.01% NA
Indica II  465 49.90% 43.70% 4.73% 1.72% NA
Indica III  913 50.20% 36.60% 7.78% 5.48% NA
Indica Intermediate  786 51.30% 35.90% 10.31% 2.54% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.20% 0.40% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 28.10% 5.21% 2.08% NA
Intermediate  90 66.70% 27.80% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407271283 G -> DEL N N silent_mutation Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg0407271283 G -> A LOC_Os04g13170.1 upstream_gene_variant ; 4011.0bp to feature; MODIFIER silent_mutation Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg0407271283 G -> A LOC_Os04g13180.1 intron_variant ; MODIFIER silent_mutation Average:28.532; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407271283 NA 2.55E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 5.19E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 2.54E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 5.34E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 1.67E-14 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 7.74E-13 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 1.48E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 NA 1.34E-15 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 9.63E-07 2.55E-15 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 4.55E-08 6.69E-30 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407271283 8.94E-12 1.34E-33 mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251