\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407264314:

Variant ID: vg0407264314 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7264314
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCTTCAAACTTTTAACTTTTTCATCACATCAAAACTTTCCTACACATACAAACTTTCAACTTTTTTGTCACATCGTTCCAATTTCAACCAAACTTT[C/T]
AATTTTGGCGTGAAAACACACCCCTAGTTTCTTTATTTCATCTTCTAAGGACGAATGGCAGATATAATTCTCCTGTATGATCTGCAAAGAAATGTATTGA

Reverse complement sequence

TCAATACATTTCTTTGCAGATCATACAGGAGAATTATATCTGCCATTCGTCCTTAGAAGATGAAATAAAGAAACTAGGGGTGTGTTTTCACGCCAAAATT[G/A]
AAAGTTTGGTTGAAATTGGAACGATGTGACAAAAAAGTTGAAAGTTTGTATGTGTAGGAAAGTTTTGATGTGATGAAAAAGTTAAAAGTTTGAAGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 35.70% 0.21% 0.00% NA
All Indica  2759 52.30% 47.30% 0.36% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 76.80% 22.90% 0.34% 0.00% NA
Indica II  465 49.50% 50.10% 0.43% 0.00% NA
Indica III  913 42.90% 56.60% 0.44% 0.00% NA
Indica Intermediate  786 46.30% 53.40% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407264314 C -> T LOC_Os04g13160.1 upstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:34.067; most accessible tissue: Callus, score: 76.892 N N N N
vg0407264314 C -> T LOC_Os04g13170.1 downstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:34.067; most accessible tissue: Callus, score: 76.892 N N N N
vg0407264314 C -> T LOC_Os04g13160-LOC_Os04g13170 intergenic_region ; MODIFIER silent_mutation Average:34.067; most accessible tissue: Callus, score: 76.892 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407264314 NA 4.86E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 5.50E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 7.40E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 1.36E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 6.76E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 4.99E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 7.02E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 5.68E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 6.26E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 1.48E-07 6.11E-23 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 8.50E-08 3.21E-15 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 1.09E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 9.29E-06 8.86E-18 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 NA 5.20E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 1.86E-12 8.97E-47 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407264314 6.18E-12 3.75E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251