Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407262262:

Variant ID: vg0407262262 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 7262262
Reference Allele: CGGAAlternative Allele: TGGA,C
Primary Allele: CGGASecondary Allele: TGGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCCCGGGTGCGCGCCCATGACGCGGGACACGGCGTGGGTGACGCCGCGTGCCGCCTCCCGCGCCTTCTTGGAGGAGTCGTCGGGAGCGCCGGGGGCGG[CGGA/TGGA,C]
GGAGGAGGAGAGGAGGTGGGCGTCGACGAGGACGAGCGGCGTGGAGCGCCAGAGCGGGCGCCAGCGGCGGGAGAGCGCGGCGGTGCGCGCGGCGTCCTTG

Reverse complement sequence

CAAGGACGCCGCGCGCACCGCCGCGCTCTCCCGCCGCTGGCGCCCGCTCTGGCGCTCCACGCCGCTCGTCCTCGTCGACGCCCACCTCCTCTCCTCCTCC[TCCG/TCCA,G]
CCGCCCCCGGCGCTCCCGACGACTCCTCCAAGAAGGCGCGGGAGGCGGCACGCGGCGTCACCCACGCCGTGTCCCGCGTCATGGGCGCGCACCCGGGCCC

Allele Frequencies:

Populations Population SizeFrequency of CGGA(primary allele) Frequency of TGGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 27.00% 0.06% 0.36% C: 0.04%
All Indica  2759 53.50% 45.90% 0.04% 0.51% NA
All Japonica  1512 99.80% 0.00% 0.07% 0.00% C: 0.13%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 23.20% 76.30% 0.00% 0.50% NA
Indica II  465 74.60% 24.70% 0.00% 0.65% NA
Indica III  913 59.30% 40.40% 0.00% 0.33% NA
Indica Intermediate  786 57.40% 41.90% 0.13% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.00% C: 0.40%
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407262262 CGGA -> C LOC_Os04g13160.1 inframe_deletion ; p.Ser117del; MODERATE inframe_variant Average:85.999; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0407262262 CGGA -> DEL LOC_Os04g13160.1 N frameshift_variant Average:85.999; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0407262262 CGGA -> TGGA LOC_Os04g13160.1 missense_variant ; p.Ala118Thr; MODERATE nonsynonymous_codon ; A118T Average:85.999; most accessible tissue: Zhenshan97 panicle, score: 95.903 unknown unknown unknown unknown

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407262262 CGGA C -0.34 -0.33 -0.36 -0.31 -0.28 -0.28
vg0407262262 CGGA TGGA -0.02 -0.02 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407262262 NA 1.94E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 NA 6.88E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 NA 2.66E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 NA 6.60E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 3.00E-06 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 8.27E-06 1.29E-10 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 NA 7.54E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 4.32E-07 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 2.08E-06 5.44E-12 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 5.69E-16 5.66E-16 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407262262 4.71E-14 4.08E-29 mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251